The Technology,Information about the latest Technology

Sony New Technology OLED TV

2009-12-07T09:58:00.000-08:00

The hidden costs of identity theft

2009-12-07T09:47:00.000-08:00

Debra Guenterberg doesn't have to go to a horror movie to get spooked. She says she's been living a nightmare for the past 13 years.

The Wisconsin woman says she's been stalked by two phantoms. Two men stole her name and her husband's Social Security number. They used the information to obtain credit cards, buy cars and three homes.

Like many horror movie villains, the bad guys keep coming back. Thirteen years after the men stole their names, the Guenterbergs are still being turned down for credit because of the damage done by the men, she says.

For More Information

Nationwide balloon-hunt contest tests online networking

2009-12-04T10:19:00.000-08:00

On Saturday, thousands of people nationwide will search the skies in a high-tech scavenger hunt designed to test how far-flung groups can use the Internet and technology to work together.

The DARPA Network Challenge calls on groups to pinpoint the locations of 10 red weather balloons scattered around the country -- with a $40,000 prize going to the first team to find them all. DARPA, which stands for Defense Advanced Research Projects Agency, is the U.S. military's research arm.

This year's contest is designed to test the the way social networking, crowdsourcing or lesser-known Web-based techniques can help accomplish a large-scale, time-critical task.

For More Information

New Future Cars - Spage Age Stuff

2009-12-03T09:52:00.000-08:00

Racist Obama image shines light on Web searching

2009-12-02T11:26:00.000-08:00

When a racist image of first lady Michelle Obama surfaced from the ugliest corners of the Internet last week to top Google's image search results, the episode shined a spotlight on the mysterious workings of search engines.

Google placed an ad near the image, apologizing for its offensive nature. But the company resisted calls to scrub the image from its database, saying its role as a neutral tool for searching the Web means having to live with the results, whether it likes them or not.

"We have a bias toward free expression," Google spokesman Scott Rubin told CNN. "That means that some ugly things will show up."

For More Information

Delta Diamond Seal Technology

2009-12-01T09:09:00.000-08:00

Activist's Web site, tweets put new face on homelessness

2009-12-01T08:53:00.000-08:00

Fourteen years ago, Mark Horvath was in crisis. The former exec was living on the streets in Hollywood, California, where for a dollar he let people take a photograph of his pet iguana, named Dog.

"I was sitting by the Chinese theater with my iguana, surrounded by Asian tourists, with my head down, thinking, 'How am I going to get out of this?' " said Horvath, whose nickname was the "Lizard Man of Hollywood Boulevard."

Last month, Horvath returned to Hollywood Boulevard, this time as a featured speaker at the 140 Characters Conference, a Twitter-inspired gathering attended by movers and shakers in social media. Horvath told the audience how he uses an arsenal of social networking sites -- Twitter, Facebook, Whrrl, MySpace, YouTube, Vimeo and Flickr -- to illuminate the plight of the nation's homeless.

For More Information

Ford's New Electric Car

2009-11-30T08:26:00.000-08:00

An e-reader shortage for the holidays?

2009-11-27T11:52:00.000-08:00

It seemed like this was going to be the holiday shopping season of the e-reader.

But that was before Barnes & Noble told customers it had run short on pre-orders of its new electronic book reader, the Nook. That device was poised to be a big holiday competitor to the more-established Amazon Kindle.

Barnes & Noble says customers who pre-order the Nook now won't get the device until the week of January 4 - after the holiday shopping season. A limited number of the devices will be available for sale in some of the "highest volume" Barnes & Noble stores.

In an e-mail, spokeswoman Mary Ellen Keating said early sales of the Nook beat the bookseller's expectations.

For More Information

Future Technology Helps Human

2009-11-27T10:27:00.000-08:00

Jet-powered Ford guns for 300 mph

2009-11-26T09:46:00.000-08:00

Joe Wilkins knew there was only one way to give his supercharged, alcohol-injected Hemi-engined hot rod more power: Put a jet engine in the trunk.

"It started as a hobby and turned into a monster," said Joe Wilkins, the motor madman behind what might be the wildest 1939 Ford ever built. He's an inventor and defense department contractor, and the idea of goosing the Ford's ability to turn heads and shred tires came when he bought a used gas turbine engine.

"I got hooked on the simplicity and power that this thing produced, and I decided one day I want to put it in a car."

For More Information

Is your date a 'stud or dud?' Ask your phone

2009-11-25T10:02:00.000-08:00

If that dreamy blind date seems too good to be true, or the guy at the bar with a martini and a pencil-thin moustache looks a little sketchy, the truth about them -- or at least some of it -- could be found on your phone.

Designers at a pair of companies say their new applications for smartphones can tell you in real time whether someone is married or divorced, has a criminal record, has filed for bankruptcy or has any number of potential red flags in their past.

Using Google to search for information on a prospective romantic partner is standard practice for many single people in the digital age. But these new apps, combined with the growth of smartphones and wireless networks, now allow for quick background checks on the go, potentially before a date is even over.

For More Information

Hot video games for holiday shopping

2009-11-24T12:42:00.000-08:00

Like a well-placed power-up, the right gift can light up the eyes of that video gamer in your life.

But for non-gamers, navigating the many offerings at your local store can be confusing. So with that in mind, here are suggestions, grouped by category, on some of the most buzzed-about games for holiday giving.

Make sure you know which gaming console (PlayStation, Xbox, Wii) your gamer has before you shop. Prices for these games will range from $30 to $60, depending on the store and any promotions or sales. Check online or at your local store for the latest pricing.

These are only a few of the games in demand this holiday season. If you have other recommendations, feel free to let us know in the comments area at the bottom of this story.

For More Informatio

Walkera Dragonfly CB-180D Super Stable Fixed Pitch RC HELI

2009-11-24T12:25:00.000-08:00

Fossil fuel chemicals avoided in plastics by Koreans

2009-11-23T08:52:00.000-08:00

A team of South Korean scientists have produced the polymers used for everyday plastics through bioengineering, rather than through the use of fossil fuel-based chemicals.

It is believed that the technique may now allow for the production of environmentally-friendly plastic that is biodegradable and low in toxicity.

The research focused on Polylactic Acid (PLA), a bio-based polymer which holds the key to producing plastics through natural and renewable resources. Polymers are molecules found in everyday life in the form of plastics and rubbers.

"The polyesters and other polymers we use everyday are mostly derived from fossil oils made through the refinery or chemical process," Professor Sang Yup Lee, who lead the research, said in a press statement.

"The idea of producing polymers from renewable biomass has attracted much attention due to the increasing concerns of environmental problems and the limited nature of fossil resources. PLA is considered a good alternative to petroleum-based plastics, as it is both biodegradable and has a low toxicity to humans."

Until now PLA has been produced in a two-step fermentation and chemical process of polymerization, which is both complex and expensive. The team used a metabolically engineered strain of E. coli and developed a one-stage process.

"By developing a strategy which combines metabolic engineering and enzyme engineering, we've developed an efficient bio-based one-step production process for PLA and its copolymers," said Lee.

"This means that a developed E. coli strain is now capable of efficiently producing unnatural polymers, through a one-step fermentation process.

"Global warming and other environmental problems are urging us to develop sustainable processes based on renewable resources.

"This new strategy should be generally useful for developing other engineered organisms capable of producing various unnatural polymers by direct fermentation from renewable resources."

The research team from KAIST University in Seoul and the Korean chemical company LG Chem published their findings in the journal "Biotechnology and Bioengineering".

Source : CNN

The New 32GB Ipod touch

2009-11-23T08:22:00.000-08:00

The New OS by Google

2009-11-20T11:27:00.000-08:00

Google today unveiled more details of Chrome OS, a lightweight, browser-based operating system for netbooks.

With a strong focus on speed, the Chrome OS promises nearly instant boot times of about 7 seconds for users to login to their computers.

"We want Google Chrome OS to be blazingly fast ... to boot up like a TV," said Sundar Pichai, vice president of product management for Google.

The first Chrome OS netbooks will be available in late 2010, Pichai said. It will not be available as a download to run and install. Instead, Chrome OS is only shipping on specific hardware from manufacturers Google has partnered with. That means if you want Chrome OS, you'll have to purchase a Chrome OS device.

Google is currently working with unnamed computer manufacturers to define specifications for these computers, which Pichai said will include larger netbook-style computers with full-size keyboards, large trackpads and large displays.

Chrome OS netbooks will not have traditional hard disk drives -- they will rely on non-volatile flash memory and Internet-based storage for saving all of your data.

All the applications will be web-based, meaning users won't have to install apps, manage updates or even backup their data. All data will be stored in the cloud, and users won't even have to bother with anti-virus software: Google claims it will monitor code to prevent malicious activity in Chrome OS web apps.

"Chrome OS is a totally rethought computer that will let you focus on the Internet, so you can stop worrying about your computer," according to a Google promotional video shown at the event, held at the Google campus in Mountain View, California.

As part of its announcement today, Pichai said that Google would be releasing all of the operating system's code and design documents to the public.

Introduced in July, Chrome OS is a Linux-based, open-source operating system centered on Google's Chrome browser. Applications will run exclusively inside the browser, Google said Thursday.

"As of today, the code will be fully open, which means Google developers will be working on the same tree as open developers," said Pichai.

The OS's focus on design is consistent with the company's stance that the future is in the web. In July, Vic Gundotra, Google's engineering vice president and developer evangelist, spoke on a panel about app stores, in which he said native apps (such as those available for the iPhone) would be obsolete in the future, and that the Web will "become the platform that matters."

"Every capability you want today, in the future it will be written as a web application," Pichai said Thursday.

Netbooks -- lightweight, low-powered sub-notebooks -- were the surprise hit of 2008 and 2009. However, with the growth of netbook sales slowing -- and the prices of some full-powered notebooks dropping below $400 -- the continued viability of the netbook sector is an open question.

Though netbook shipments are falling below manufacturers' expectations, the inexpensive, low-powered devices appear to still be selling well. Pichai cited research figures from ABI research indicating that 35 million netbooks shipped in 2009, more than twice the number sold in 2008.

Manufacturers have yet to announce pricing on netbooks shipping with Chrome OS, but Google expects the cost to be about the same as current netbooks. On average, netbooks cost between $300 and $500.

Videos demonstrating Chrome OS's user interface, security, fast boot and other features are below the jump.

Solar Photovoltaic Technology

2009-11-18T09:55:00.000-08:00

Solar cells, also called photovoltaic (PV) cells by scientists, convert sunlight directly into electricity. PV gets its name from the process of converting light (photons) to electricity (voltage), which is called the PV effect. The PV effect was discovered in 1954, when scientists at Bell Telephone discovered that silicon (an element found in sand) created an electric charge when exposed to sunlight. Soon solar cells were being used to power space satellites and smaller items like calculators and watches. Today, thousands of people power their homes and businesses with individual solar PV systems. Utility companies are also using PV technology for large power stations.

Solar panels used to power homes and businesses are typically made from solar cells combined into modules that hold about 40 cells. A typical home will use about 10 to 20 solar panels to power the home. The panels are mounted at a fixed angle facing south, or they can be mounted on a tracking device that follows the sun, allowing them to capture the most sunlight. Many solar panels combined together to create one system is called a solar array. For large electric utility or industrial applications, hundreds of solar arrays are interconnected to form a large utility-scale PV system.

Traditional solar cells are made from silicon, are usually flat-plate, and generally are the most efficient. Second-generation solar cells are called thin-film solar cells because they are made from amorphous silicon or nonsilicon materials such as cadmium telluride. Thin film solar cells use layers of semiconductor materials only a few micrometers thick. Because of their flexibility, thin film solar cells can double as rooftop shingles and tiles, building facades, or the glazing for skylights.

Third-generation solar cells are being made from variety of new materials besides silicon, including solar inks using conventional printing press technologies, solar dyes, and conductive plastics. Some new solar cells use plastic lenses or mirrors to concentrate sunlight onto a very small piece of high efficiency PV material. The PV material is more expensive, but because so little is needed, these systems are becoming cost effective for use by utilities and industry. However, because the lenses must be pointed at the sun, the use of concentrating collectors is limited to the sunniest parts of the country.

New Technology Prolongs Produce Freshness

2009-11-16T08:39:00.000-08:00

Nutritionists encourage eating a healthy diet rich in fresh fruits and vegetables. In response, consumers flock to their grocery stores and stock up these healthful foods. Too often, though, produce spoils soon after purchase. This is becoming more common as more produce is imported from around the world.

The cause of the untimely spoilage is ethylene, a plant hormone that fruits and vegetables produce naturally as they ripen. Even at temperatures colder than 39° Fahrenheit, apples and avocados produce high quantities of ethylene. The situation is complicated when fruits and vegetables are packaged for long trips—as the air in the confined container circulates, the concentration of ethylene gas, even as low as .01 parts per million, accelerates the ripening of stored produce.

Postharvest losses due to spoilage, estimated at 30 to 40 percent worldwide, affect the economic success of growers, packers, storage houses, and distributors of produce.

With funding from USDA’s Cooperative State Research, Education, and Extension Service (CSREES), Dr. Reza Shekarriz and W. L. Allen of Fluid Analytics, Inc., in Lake Oswego, Ore., have developed a compact sensor to accurately measure low concentrations of ethylene on transport containers.

“This issue is becoming more critical as global trade and year-round consumption of fresh fruits and vegetables increases,” Shekarriz said. “Ethylene-related problems make up a significant portion of postharvest losses in developing countries, resulting in negative economic impacts worth billions of dollars every year.”

Produce freshness can be controlled by carefully monitoring and regulating exposure to ethylene during transport. Reducing produce exposure to ethylene slows the natural ripening process, thereby extending produce shelf life.

The new sensor continuously samples air at a regulated flow rate, normally 12 to 30 cubic inches of air per minute. Not only can the sensor detect ethylene at concentrations low enough to ripen produce, it also reports ethylene concentration in real-time to provide greater control over ethylene levels during transport.

“This sensor is far more sensitive to ethylene detection than previous technology. Future developments may increase sensitivity to provide better response times and will be integrated with ethylene scrubbers to actively remove ethylene from cold storage rooms and shipping containers” said Shekarriz.

This device is particularly important for organic produce that does not use other chemicals to control the ripening process.

The beneficiaries of this new sensing technology include horticulture and floriculture research institutions, growers, packing houses, cold-storage facilities, greenhouses, shipping containers, and consumers.

Scientists in the United States, Germany, England, France, and the Netherlands are already using prototypes of the ethylene sensor. Future work by this research team will focus on developing new technology to remove ethylene from an enclosed space to further reduce the complications of postharvest ripening.

This technology has been licensed to a French company, ABSOGER, for commercialization into the European cold storage market. The commercial units are expected to reach the market in mid-2009.

Thermally Modified Wood

2009-11-13T11:44:00.000-08:00

Thermally modified wood is produced by subjecting solid wood to high temperatures to improve their dimensional stability and biological durability. Solid wood is exposed t 160-240 ^oC in an atmosphere of low oxygen content or oil is used to transfer heat to the wood.

The wood’s properties can be altered by modifying its cell wall components using heat. Portions of hemicelluloses are hydrolyzed into to their monosaccharide components such as glucose, galactose, mannose, arabinose and xylose The amorphous regions of cellulose are also hydrolyzed, breaking cellulose into shorter chains. The degradation of the cell wall’s two major components leads to reduced free hydroxyl groups in the chemical structures and increased cross-linking of lignin.

The modifications result in several changes in the wood’s properties. The following are basic properties of thermally modified wood, regardless of the kind of thermal modification ™ process used: (1) decreased heat conductivity by 10 – 30%; (2) decreased mechanical strength by up to 30%; (3) reduced weight by 5 – 15%; (4) decreased shrinking and swelling by 50-90% due to reduced equilibrium moisture content of the wood; (5) improved biological durability; (6) extractives migration to the wood surface, and (7) color change from whit or yellow to dark brown.

Commercial production of thermally modified wood started in the late 1990’s in Europe. ThermoWood. PlatoWood, Retification and Perdure, and Oil-heated wood of Finland, Netherland, France and Germany, respectively, are some of the popular TM processes.

Green, air-dried and kiln dried wood can be thermally modified depending on the TM process used. For example, in the Finnish Thermowood process, green wood is first dried above 100 0c. Thermal modification follows after the desired moisture content of 10% is reached. The treatment temperature and duration will vary depending on the wood’s end-uses.

In 1974, FPRDI started conducting studies on thermal modification. Mailum and Arenas subjected five local wood species to different temperatures ( 130, 150 and 175 ⁰C). Results showed improvement in the natural durability of acacia [Samanea saman (Jacq.) Merr.], guijo [Shorea guiso (Blanco) Blume], mayapis [Shorea palosapis (Blanco) Merr.] and palosapis {Anisoptera thurifera (Blanco) Blume spp. Thurifera] against two decay fungi species, i. e. Fomes liviudus, a white-rot fungus and Lenzies striata, a brown-rot fungus.

However, no similar studies followed thereafter until a 2009 research on plantation species, malapapaya [Polyscias nodosa (Blume) Seem.]. Malapapaya was thermally modified to improve its physico-mechanical properties and decay resistance using different combinations of temperature and treatment durations. Results showed significant improvement on the biological durability and dimensional stability, as well as color change in malapapaya wood.

Piston Clearance - Industrial Gas Technology - How To

2009-11-12T09:56:00.000-08:00

How To: Jailbreak 3.0 iPod Touch 1g & 2g, iPhone, iPhone 3g On Windows/Mac

2009-11-11T12:52:00.000-08:00

New and Emerging Environmental Technology (NEET)

2009-11-10T09:23:00.000-08:00

The NEET website is an on-line repository for information about technologies that prevent, remove, destroy, sample, monitor, or model air pollutant emissions from stationary, mobile, and indoor sources. NEET contains information about technologies for improving air quality that are commercially available, as well as technologies that are currently being developed. You use NEET's search features or the technology provider directory to find technologies listed in NEET that meet your needs.

All owners, manufacturers, developers, and research sponsors of air technologies are invited to list their technologies in the NEET database. Adding your technology is an easy on-line procedure that you perform with your own password-protected account. Your technology can be a commercially available technology or an emerging technology in research and development. Listing technologies is free.

The U.S. Environmental Protection Agency's Office of Air Quality Planning and Standards selected RTI International as its cooperative agreement partner for developing and operating a web-accessed database to serve as an information resource for new and emerging air technologies.

2009 NEW AIR CONDITIONER EVAPORATOR SYSTEM CLEANER

2009-11-09T11:48:00.000-08:00

Hands-on with Verizon's HTC Droid Eris

2009-11-07T00:35:00.000-08:00

Dry Ice Technology - worlds Fastest R100 Auto

2009-11-05T11:47:00.000-08:00

Fuel injection

2009-11-04T09:34:00.000-08:00

Fuel injection is a system for mixing fuel with air in an internal combustion engine. It has become the primary fuel delivery system used in gasoline automotive engines, having almost completely replaced carburetors in the late 1980s.

A fuel injection system is designed and calibrated specifically for the type(s) of fuel it will handle. Most fuel injection systems are for gasoline or diesel applications. With the advent of electronic fuel injection (EFI), the diesel and gasoline hardware has become similar. EFI's programmable firmware has permitted common hardware to be used with different fuels. Carburetors were the predominant method used to meter fuel on gasoline engines before the widespread use of fuel injection. A variety of injection systems have existed since the earliest usage of the internal combustion engine.

The primary difference between carburetors and fuel injection is that fuel injection atomizes the fuel by forcibly pumping it through a small nozzle under high pressure, while a carburetor relies on low pressure created by intake air rushing through it to add the fuel to the airstream.

The fuel injector is only a nozzle and a valve: the power to inject the fuel comes from a pump or a pressure container farther back in the fuel supply.

Industrial R&D Promotion Programme

2009-11-03T09:19:00.000-08:00

Introduction

Department of Scientific & Industrial Research (DSIR) is the nodal department for granting recognition to in-house R&D units in Industry, Scientific and Industrial Research Organizations (SIROs); and registration to Public funded research Institutions, universities, IIT’s, IISc, Regional Engineering College (RECs), other than hospitals.

Secretary, DSIR is the prescribed authority vide Gazette notification No.S.O.85 (E) dated 31st January, 2001 issued by Department of Revenue, Ministry of Finance for granting approval to commercial R&D companies Under Section 80IB (8A) of I.T. Act, 1961; also approval to in-house R&D Centres under Section 35(2AB) of I.T Act 1961 for Weighted Tax Deduction.

In-house R&D units recognized by DSIR in the area of pharmaceutical and bio-technology sector are eligible for duty free import of specified goods (comprising of analytical and specialty equipment as per list 28) for R&D as per notification No. 26/2003-customs dated 1st March, 2003 (item at Sl. No. 248(1); and duty free import of specified goods (comprising of analytical and specialty equipment as per list 28) for production as per notification No.26/2003-customs dated 1st March, 2003 (item at serial No.248(2); and duty free import of pharmaceutical reference standards as per notification No.26/2003-Customs dated 1st March, 2003 (item at serial No.138); and also the in-house R&D units engaged in the research and development in the area of chemical, drugs pharmaceuticals, (including clinical trials), bio-technology, electronic equipments, computers, telecommunication equipments, aircrafts and helicopters are eligible for weighted tax deduction of a sum of equal to one and one-half times of any expenditure incurred on scientific research (not being expenditure in the nature of cost of any land building) as approved by the prescribed authority i.e. Secretary, DSIR. In case of dispute, Secretary, DSIR is also prescribed authority in concurrence with Director General of Income-Tax (Exemption) for deciding cases of R&D expenditure made on Capital Equipment and related R&D activities under Section 35 of Income-Tax Act, 1961 referred by Central Board of Direct Taxes.

A few more incentives introduced by the Government to encourage R&D by industry include write off of revenue and capital expenditure on R&D, weighted tax deduction on sponsored research programmes of industry with National Laboratories/Universities /IITs; accelerated depreciation allowance on plant and machinery set up indigenous technology, custom duty exemption on goods imported for use in Government funded R&D projects, excise duty waiver for 3 years on goods produced based on indigenous technologies and duly patented in any two of the countries out of India, European Union(One Country), USA and Japan.

Scientific & Industrial Research Organizations in the area of Medical Agriculture, Natural and Applied Sciences and Social Sciences recognized by DSIR are eligible for notification under Section 35 (1) (ii)(iii) of I.T Act 1961 and also for availing Custom and Excise duty exemption.

Commercial R&D companies approved by DSIR before 1st April, 2004 are eligible for 10 years tax holidays.

Public Funded R&D Institutions registered by DSIR are eligible for availing custom duty exemption on import of equipment, spares and accessories and consumables as per notification No.51/96-Customs dated July, 23, 1996 and also for availing Central Excise Duty Waiver on purchase of indigenously manufactured items as per notification No. 10/97- Central Excise dated March 1, 1997 for scientific research purposes.

Objectives

* The broad objectives are to:

* Bring in-house R&D into sharper focus;

* Strengthen R&D infrastructure in industry and SIROs;

* Promote R&D initiatives of the industry and SIROs ;

Ensure that the contributions made by the in-house R&D centres and SIROs dovetail adequately in the overall context of technological & industrial development

Advanced Diamond Technologies

2009-11-02T09:01:00.000-08:00

ADT is the world leader in the development and application of diamond films for industrial, electronic and medical applications. ADT’s patented diamond, known as Ultrananocrystalline Diamond, is prized for its exceptionally small (5 nanometer) grain sizes, which are a billion-fold smaller in volume than those in traditional diamond films. It is the exceptionally small grain sizes that make UNCD distinct from other diamond films and, like other nanotechnologies, are the source of its enabling value.

Formed in December 2003, ADT provides diamond film and materials integration solutions to a variety of industry participants in diverse application areas. It is based in Champaign, IL. Its website is www.thindiamond.com.

Napoleon Arlington Gas Stoves

2009-10-30T10:01:00.000-07:00

Integrated Starter/Generator (ISG)

2009-10-29T09:58:00.000-07:00

These systems automatically turn the engine off when the vehicle comes to a stop and restart it instantaneously when the accelerator is pressed so that fuel isn't wasted for idling. In addition, regenerative braking is often used to convert mechanical energy lost in braking into electricity, which is stored in a battery and used to power the automatic starter.

The Freaky F-35 Lid

2009-10-28T10:30:00.000-07:00

Fighter pilots get a clear vision By Gazette Reporter Futuristic new helmets will enable fighter jet pilots to see through their own aircraft, the Ministry of Defence said today.

The head gear being developed for the hi-tech F-35 Joint Strike Fighter is being tested by MoD scientists at Boscombe Down in Wiltshire.

An MoD spokesman said: "Unlike other jet aircraft the JSF, which is planned to replace the Harrier, does not have a traditional head-up display.

Instead the computerised symbology will be displayed directly on to the pilot's visors, providing the pilot with cues for flying, navigating and fighting the aircraft.

"It even will superimpose infra-red imagery on to the visor to allow the pilot to look through the cockpit floor at night and see the world below - like something out of Terminator.

"This is absolutely the cutting edge of technology. No other helmet will be able to do this."

The head gear, currently at prototype stage, is being developed by Vision Systems International and Helmet Integrated Systems Limited.

Human Research Program - Advanced Food Technology

2009-10-27T09:13:00.000-07:00

The Advanced Food Technology (AFT) project is part of the Space Human Factors and Habitability (SHFH) element of the Human Research Program (HRP). The ultimate goal of AFT is to develop and deliver technologies for human centered spacecraft that will support crews on missions to the moon, Mars, and beyond.

AFT is responsible for developing food systems for space vehicles and long duration missions that use a combination of extended shelf life stored foods and raw food products produced from higher plants or bulk raw commodities. AFT research addresses nutritional, psychological, safety, and acceptability requirements, while minimizing mass, volume, power, waste and trace gas emissions. In doing so, the AFT must address different mission scenarios that present challenges beyond conventional knowledge concerning food.

The goals of the AFT are to:

Develop a stored food system that is nutritious, palatable and provides a sufficient variety of foods to support significant crew activities on a mission of at least 3 years duration. Foods should maintain safety, acceptability, and nutrition for the entire shelf life of 3 - 5 years. Shelf life extension may be attained through new food preservation methods and/or packaging.
Develop new packaging technologies to minimize waste from packaged food.
Develop handling procedures for minimally processed vegetable crops.
Develop equipment to process crops in reduced gravity that are highly automated, highly reliable, safe, and minimize crew time, power, water, mass, and volume.
Develop recipes, galley operations, and galley equipment for extended surface missions.

Current activities of the AFT are concentrating on near term needs in order to augment the Shuttle and ISS food system while working towards an advanced food system. Activities include:

Shelf life testing of thermally processed foods.
Identification and testing of packaging materials with high barrier properties and low mass and volume.
Investigation of emerging preservation technologies that wil provide extended shelf life food items with improved nutrition and acceptability.

Wild dog check fences

2009-10-26T09:06:00.000-07:00

The wild dog check fences were built to protect animals in the adjacent cropping and grazing lands. Although the check fences do not physically link up with the wild dog barrier fence, they play an important role in wild dog control in southern Queensland.

Some sections of the Darling Downs-Moreton Rabbit Board fence are top-netted to wild dog-proof standard, and these form part of the check fences.

In 1984 the wild dog check fences were restored by the state government as part of the wild dog barrier fence restoration program. They were then handed over to local governments, with the agreement that they would oversee and fund the maintenance of the fences to a dog-proof standard. Most of the fences have been well maintained and have been improved from their original condition.

The map below shows the location of the check fences in relation to the wild dog barrier fence and the Darling Downs-Moreton Rabbit Board fence.

Unbreakable Fighting Umbrella

2009-10-24T00:11:00.000-07:00

Size matters in Samsung's latest hard drive offerings

2009-10-23T10:39:00.000-07:00

Tennis Racket Shapped Collector

2009-10-22T09:39:00.000-07:00

The aerogel aboard the Stardust Spacecraft is fitted into a "tennis racket" shaped collector. This is unfolded from the protective Sample Return Capsule to expose it to space during flight. One side of the collector will be faced towards the particles in Comet Wild 2, while the reverse, or B side, will be turned to face the streams of interstellar dust encountered during its journey.

When hypervelocity particles are captured in aerogel they produce narrow cone-shaped tracks that are hollow, and can easily be seen in the highly transparent aerogel by using a stereomicroscope. This cone is largest at the point of entry, and the particle is held intact at the point of the cone. This provides a method for determining which direction the dust came from, and is the basis of the approach of using single slabs of aerogel to collect both cometary and interstellar dust from both sides.

After the encounter with Comet Wild 2, the aerogel collector will be retracted into the Sample Return Capsule (SRC) and returned to Earth for detailed analysis by scientists at the NASAs Johnson Space Center.

A New Camera for Extrasolar Planets

2009-10-21T09:44:00.000-07:00

It hasn't found planets yet—but in its first year of operation, the instrument has already proved its worth.

For the better part of a year, an international team of astronomers has been working with a powerful new camera that may soon yield the first images of planets in other solar systems—and already, it has made some significant discoveries.

The Simultaneous Differential Imager (SDI) was jointly built by the University of Arizona’s Laird M. Close, who is working under a five-year CAREER grant from the National Science Foundation, and by Rainer Lenzen of the Max Planck Institute of Astronomy in Heidelberg, Germany. Its first target was Saturn’s moon Titan: during the instrument’s commissioning run early last year at the European Southern Observatory’s Very Large Telescope in Chile, the astronomers obtained maps of Titan’s smog-shrouded surface that were almost as detailed as those made a few months later by the Cassini spacecraft. Shortly after, the researchers discovered a very rare, low-mass “brown dwarf binary” pair called Epsilon Indi Ba and Bb. Brown dwarfs are blobs of gas too small to shine like a star, but too big and warm to be called planets. Epsilon Indi Ba and Bb are only the third brown-dwarf pair known.

And then, as the astronomers described in the Jan. 20, 2005, issue of the journal Nature, SDI images of the very young star AB Doradus A revealed a brown dwarf companion having 93 times the mass of Jupiter, the largest planet in our own solar system—which makes this particular brown dwarf almost twice as heavy as theory predicted it should be based on its observed brightness.

“This discovery will force astronomers to rethink what the masses of the smallest objects produced in nature really are,” says Close.

In the meantime, he adds, the SDI team is continuing the search for actual planets, which are expected to be far dimmer than the brown dwarfs. That dimness is one big reason why no extrasolar planet has ever been imaged directly: they are lost in the glare of their parent stars. (The 120-plus extrasolar planets that have been found to date have all been detected indirectly, mostly through their effects on the motion of their parent stars.)

To eliminate this glare, the SDI first relies on its host telescope’s standard “adaptive optics” system to remove the blurring effects of Earth's atmosphere. Then the SDI takes the sharply focused light from a particular target star, and beams it into an internal optical system that is sensitive to light emitted by methane: a carbon compound thought to be abundant in the atmospheres of gas-giant planets. After some further computer processing, the result is a synthetic image in which the light from the star has been subtracted out, leaving nothing but the images of any faint, cool, methane-rich companions.

The SDI team has looked at about 20 stars so far, says Close, and the data are currently being analyzed—mainly by University of Arizona graduate student Beth Biller. “No confirmed planets yet,” he says, “but we should be able to detect planets some 20,000 times fainter than their primary star.”

Moreover, he says, the SDI’s direct imaging approach should nicely complement the standard method of looking for planets’ indirect effects on the parent star’s motion. “That technique is better for giant planets orbiting close in,” he says, “whereas ours should do better for giant planets like Jupiter or Saturn in our own solar system, which orbit further out.”

New Pacific Air Force Technologies Fly

2009-10-20T09:09:00.000-07:00

The U.S. Pacific Air Forces are rolling out new technologies and capabilities to government and industry partners while seeking to consolidate for efficiencies. But, its vice commander bemoans continuing cultural and technological hurdles to effective network centricity.

Among the new capabilities are voice over secure Internet protocol (VoSIP), which is in four bases and will be installed in all nine bases over the next 12 months. Airmen also are receiving secure mobile personal digital assistants with Defense Information Systems Agency (DISA) security for sending secure e-mail. And, network operations and CERT functions are consolidated into single Air Force network operations.

But Maj. Gen. Mike Hostage III, USAF, vice commander, Pacific Air Forces, wants effective systems delivered on time. “A perfect course of action late to the fight isn’t as good as a 90-percent solution delivered on time,” he said. And, these systems should serve military needs, not those of industry.

The Army can provide ballistic missile defense capabilities to the Pacific Air Forces’ air operations center. This helps improved missile threat defense. But, this data must be displayed on a separate monitor. Gen. Hostage wants that data to be consolidated with Air Force data so it can appear on a common monitor.

And, industry needs to build solutions based on Air Force needs, not its own capabilities. Gen. Hostage told industry, “Show us what you’ve got, look at our problem set, then help draw the links between the two.”

New Technology Allows Prisoner to Talk to Family

2009-10-19T09:34:00.000-07:00

Electronic cigarette

2009-10-15T07:38:00.000-07:00

An electronic cigarette or "e-cigarette" is a battery-powered device that provides inhaled doses of nicotine by heating a nicotine-chemical solution into a vapor. It is an alternative to smoked tobacco products, such as cigarettes, cigars, or pipes. In addition to nicotine delivery, this vapor also provides a flavor and physical sensation similar to that of inhaled tobacco smoke, while no tobacco, smoke, or combustion is actually involved in its operation.

An electronic cigarette usually takes the form of some manner of elongated tube, though many are designed to resemble the outward appearance of real smoking products, like cigarettes, cigars, and pipes. A common design is also the "pen-style", so named for its visual resemblance to a ballpoint pen.

Most electronic cigarettes are reusable devices with replaceable and refillable parts. A number of disposable electronic cigarettes have also been developed.

The legal status of electronic cigarettes varies by country.

Mobile Radio Data Technology

2009-10-14T10:33:00.000-07:00

Mobile Data Radio technology shares its resources among users in a similar manner to a modern local area network. Coverage and capacity can be increased by simply adding base stations. The MDRS, which is based on highly scalable Mobitex technology, has the capability to be expanded up to 12,500 base stations.

The MDRS network’s componentry is designed for easy location and installation. Its small, uncomplicated units consist of a Data Radio Base Station, the MX Data Network Switch and the NCC Network Control Centre.

This streamlined, modular architecture makes for an extremely efficient and flexible management regime. The network can be precisely configured to match a particular service mix and meet expected solution requirements. Then, as demand and service uptakes change over time, the network can be easily re-configured.

While MDRS bears some similarity to the digital cellular technology of today’s mobile phone systems, it is unique in several respects. Firstly, as a narrowband technology designed for wireless data communication, it uses packet switching to maximise spectrum efficiency. Secondly, it is a dedicated, data-only network that is based on an open, international standard.

This means, that over the greatest number of wireless data applications, MDRS is the most cost-effective technology.

In the field, MDRS can be relied upon to meet the requirements of public safety and business-critical applications. By ensuring that real time data is available onsite and on-demand, MDRS empowers its users to respond in a timely manner.

Sony Rolly in Motion

2009-10-13T08:22:00.000-07:00

Computer Security Objects Register (CSOR)

2009-10-12T10:34:00.000-07:00

Information objects that convey information used to maintain the security of resources in computerized environments are known as Computer Security Objects (CSOs). The Computer Security Objects Register (CSOR) specifies names that uniquely identify CSOs. These unique names are used to reference these objects in abstract specifications and during the negotiation of security services for a transaction or application. The CSOR is also a repository of parameters associated with the registered objects. For agencies requesting a new OID, please send email with OID name, associated document and point of contact information.

The CSOR is currently registering the following objects:

Security Label
Information Object Security Program
Public Key Infrastructure
Cryptographic Algorithm

New registration branches and their object-specific requirements will be defined as the need arises.

CSOR Documents

The following documents are referenced throughout this CSOR web site:

Federal Information Processing Standards (FIPS)
NIST Interagency Reports
Secure Data Exchange (SDE) Security Label (802.10g - 1995)
Defines the security label format for the IEEE802.10 Secure Data Exchange (SDE)

CSOR Disclaimer

The registration service presented here does not provide an endorsement or approval for techniques, algorithms, or products using the specifications maintained. Similarly, there is no explicit or implicit indication of the correctness or suitability of registered computer security objects for any use. Use of the Computer Security Objects Register (CSOR) is not mandatory, although recommended as a tool for achieving interoperability. Conflicts with ownership and/or rights over alpha-numeric object names and specifications must be resolved by applicants prior to the submission of a request for registration. The registration of a security object assigns the applicant no rights over the object or its name and is therefore no absolute proof of ownership. Registered objects and their names may be protected by copyrights and or patents and their use by others than the owner may require special arrangements without the involvement of the Registration Authority. Upon requesting registration, applicants give the Registration Authority permission to reproduce and distribute the names and specifications of all objects being registered.

Bar Code Technology

2009-10-09T10:30:00.000-07:00

Since their invention more than 50 years ago, bar codes have been enablers for accurate data capture, the rapid movement of goods, and all types of automation. Whether at the Point-of-Sale, in a hospital, or in a manufacturing environment these little black and white images deliver incredible value.

There are many different bar code symbologies, or languages. Each symbology has its own rules for encoding characters (e.g., letter, number, punctuation), printing, decoding requirements, and error checking.

Bar code symbologies differ both in the way they represent data and in the type of data they can encode: some encode numbers; others encode numbers, letters, and a few punctuation characters; still others offer encodation of the 128 or 256 ASCII character sets. Recently unveiled symbologies include options to encode characters in any language as well as specialized data types.

Bar codes in common use are covered by international standards. International standards also cover print quality measurements and equipment.

Bar code technology standards define:

Rules for representing data in an optically readable format,
Rules and techniques for printing or marking,
Reading and decoding techniques, and
Rules for measuring the quality of printed/marked symbols

Alternative Fuel Technology Works by Argonne National Lab

2009-10-08T10:28:00.000-07:00

New Chemical Exposure Limits (NCELs)

2009-10-07T09:33:00.000-07:00

Under section 5 of the Toxic Substances Control Act (TSCA), any person who intends to manufacture or import a new chemical substance in the United States for commercial purposes must submit a premanufacture notice (PMN) to the Environmental Protection Agency (EPA) at least 90 days prior to manufacture or import. EPA's Office of Pollution Prevention and Toxics (OPPT) performs a risk assessment and makes a risk management decision.

If EPA determines, among other things, that the PMN substance may present an unreasonable of injury to human health via inhalation exposure, EPA is likely to issue a TSCA section 5(e) Consent Order. The section 5(e) Order is likely to require, among other things, that potentially exposed employees of the Company must wear specified respirators unless actual measurements of the workplace air show that air-borne concentrations of the PMN substance are below a New Chemical Exposure Limit (NCEL) that is established by EPA to provide adequate protection to human health.

In addition to the actual NCEL concentration, the comprehensive NCELs provisions, which are modeled after Occupational Safety and Health Administration (OSHA) Permissible Exposure Limits (PELs), include requirements addressing performance criteria for sampling and analytical methods, periodic monitoring, respiratory protection, and recordkeeping. EPA generally extends these section 5(e) Order requirements to other manufacturers and processors of the same chemical substances via a section 5(a)(2) Significant New Use Rule (SNUR).

NCELs Table -- The NCELs Table lists the actual NCEL concentrations established by EPA for specific chemical substances regulated by section 5(e) Orders. The NCELs Table is intended to provide a convenient list of all NCELs established by EPA (up to the date of Internet posting). This list of NCELs concentrations is not published in the Code of Federal Regulations (CFR) or elsewhere. To protect Confidential Business Information (CBI) under section 14 of TSCA, the NCELs Table gives generic descriptions of those PMN substances for which the company claimed the chemical identity as CBI.

CAVEAT -- The NCELs Table is for informational purposes only and is NOT itself legally controlling. Any discrepancies should be resolved in favor of the corresponding section 5(e) Order or section 5(a)(2) SNUR. The NCELs Table does not describe the other comprehensive requirements that are associated with the actual NCEL concentration and that are also imposed by the section 5(e) Order or section 5(a)(2) SNUR.

Mobile Communication Technology for Adolescents With Diabetes

2009-10-06T09:52:00.000-07:00

Among patients with type I diabetes, adolescents struggle the most with self-management, which often results in poor glycemic control. Optimizing parent-patient interaction is crucial to improving self-management. Mobile technology with integrated glucose monitoring capability that links adolescents to providers may reduce parental hypervigilance and assist them to better understand self-management. .

This study will investigate a novel cell phone glucose monitoring system (CPGM) with the following specific aims:

1. To establish feasibility of a CPGM system as a component of an adolescent diabetes management program.
2. To determine if the technology will improve a) quality of parent-child relationship, b) patient quality of life, c) competence in diabetes management, and d) metabolic control.
3. To gather preliminary data for development of future intervention studies.

120 adolescents with type I diabetes will be randomly assigned to either an experimental or control group.

Experimental subjects will use the CPGM which will transmit all blood glucose data to a host computer. A nurse practitioner in the pediatric endocrinology clinic will determine need for telephone contacts based on evaluation of transmitted data. Subjects might be telephoned to discuss possible regimen adjustments, need for clinic visits, or referrals to additional services. Subjects will also be able to initiate contact with the project nurse. Control subjects will continue to receive standard care. .

This study will assess the effect of the intervention in the four primary domains stated in the specific aims.

These domains will be measured at baseline, three months, and six months.

Air Car by Guy Negre on BBC America

2009-10-05T09:28:00.000-07:00

Vapour recovery at petrol service stations

2009-10-02T03:40:00.001-07:00

In 2002, the Department of Environment and Climate Change (DECC) commenced evaluation of vapour recovery technology at service stations to reduce the emission of petrol vapours during refuelling of vehicles.

This technology is known as Stage 2 vapour recovery or 'VR2'. Over the last 20 years VR2 has been successfully introduced across the United States, Europe and in many parts of Asia to reduce local, regional and global air pollution.

In August 2007, DECC released a discussion paper seeking public comment on a proposal to expand vapour recovery at service stations in the Greater Metropolitan Region (GMR) of NSW.

As a result of this consultation, in November 2007 the State Government announced its intention to:

expand the Stage 1 vapour recovery technology already in use at service stations in Sydney to the Central Coast, Illawarra and Lower Hunter
phase in Stage 2 vapour recovery technology at service stations in the Sydney, Central Coast, Wollongong and Newcastle metropolitan areas.

Top 10 Smart phones in the year 2009

2009-10-01T10:14:00.000-07:00

Nuclear Medicine Technologists

2009-09-30T09:42:00.000-07:00

Significant Points

Two-thirds of nuclear medicine technologists worked in hospitals.
Nuclear medicine technology programs range in length from 1 to 4 years and lead to a certificate, an associate degree, or a bachelor’s degree.
Faster-than-average job growth will arise from an increase in the number of middle-aged and elderly persons, who are the primary users of diagnostic and treatment procedures.
The number of job openings each year will be relatively low because the occupation is small; technologists who also are trained in other diagnostic methods, such as radiologic technology or diagnostic medical sonography, will have the best prospects.

New Weather Technology Helps NOAA Storms Lab Develop Pilot Program

2009-09-29T09:25:00.000-07:00

When a hurricane or severe storm hits North Carolina, South Carolina or Virginia - as Hurricane Floyd did in 1999 - weather forecasters now anticipate delivering more accurate flood and flash flood warnings.

Scientists are testing new advanced weather technology in a pilot program from the National Oceanic & Atmospheric Administration's (NOAA) National Severe Storms Laboratory (NSSL), NOAA's National Sea Grant College Program and North Carolina and South Carolina Sea Grant state programs.

New software that utilizes Doppler radar data, satellite imagery and other information tools will monitor rainfall in watershed basins as small as one square kilometer.

National Weather Service (NWS) forecasters can use the data to issue more precise and accurate flood and flash flood warnings. Emergency management officials, utility companies and others can use data to better prepare for flood events.

With new technology, researchers hope to mitigate losses such as the tremendous damage caused by Hurricane Floyd. In North Carolina, for example, the statistics were staggering - 52 deaths, 7,000 homes destroyed, 17,000 uninhabitable homes and 57,000 homes damaged.

"This will help save lives and protect property," said North Carolina Sea Grant marine educator Lundie Spence, who was one of several Sea Grant representatives who visited NSSL last year in an effort to develop joint projects within the two NOAA agencies.

"If we can assist the local NWS Forecast Office with implementation of new technology that provides additional details about a severe storm system, specific amounts of rainfall and the type of precipitation, people will have more opportunity to prepare to evacuate areas," Spence added.

The project has two phases: collecting regional radar data in "real time" at a single location at Wilmington, N.C., and creating Web-based flash flood guidance software using real time radar data.

The regional or multi-state images, which will be available by late September, will combine raw data from several National Weather Service Doppler radars in coastal North and South Carolina and coastal southern Virginia.

Currently, each NWS office can only get Doppler radar data from one or two radars at a time," said Kevin Kelleher, deputy director of the National Severe Storms Lab in Norman, Okla.

"With this new technology, we will be able to provide regional, multi-radar images and forecast products using realtime Doppler data to NWS forecasters and emergency managers extending from coastal Georgia to Washington, D.C.," Kelleher added.

"The ability to receive multi-sensor estimates of accumulated rainfall for individual river basins should really be helpful in managing flood situations."

By December, the second phase of the project will be nearly complete. Data will be available on the World Wide Web to a variety of users, including weather forecasters, emergency management officials, mariners, scientists and commercial users in the power and agricultural sectors. The data will include information on the amount of rainfall that has fallen in each river basin and an indication of the likelihood that flooding will occur.

"Web-based data will include color maps that will help emergency management officials more quickly and accurately identify the areas at greatest risk for flood," said South Carolina Sea Grant extension program leader Robert Bacon. "For example, they can more effectively target areas for evacuation and position their response and recovery resources to assist flood victims."

The National Sea Grant Program is a university-based program that promotes the wise use and stewardship of coastal and marine resources through research, outreach and education.

Ford's New Car in India

2009-09-24T11:07:00.000-07:00

Ford has pronounced that it is to make a latest car in India, as part of its $500m (£304m) investment plan in the country.

Manufacturing will begin on the Ford Figo at the carmaker's plant in Chennai in the first quarter of 2010.

Ford has described the Figo - which is Italian slang for "cool" - as a "game changer" and said it was confident it would be popular with Indian consumers.

The Figo will compete in India's small car segment, which makes up about 70% of the new vehicle market.

The car will initially only be for sale in India, but there are plans to export it to other countries, Ford said.

In April, the world's cheapest car, the Tata Nano, went on sale in India. The Nano is 10 feet (3 metres) long.

"[The Figo] reflects our commitment to compete with great products in all segments of this car market," said Ford president and chief executive Alan Mulally.

"We are confident the Ford Figo will be a product that Indian consumers really want and value."

Fuel Cell Vehicles

2009-09-23T09:39:00.000-07:00

Although they are not expected to reach the mass market before 2010, fuel cell vehicles (FCVs) may someday revolutionize on-road transportation.

This emerging technology has the potential to significantly reduce energy use and harmful emissions, as well as our dependence on foreign oil. FCVs will have other benefits as well.

A Radical Departure

FCVs represent a radical departure from vehicles with conventional internal combustion engines. Like battery-electric vehicles, FCVs are propelled by electric motors. But while battery electric vehicles use electricity from an external source (and store it in a battery), FCVs create their own electricity. Fuel cells onboard the vehicle create electricity through a chemical process using hydrogen fuel and oxygen from the air.

FCVs can be fueled with pure hydrogen gas stored onboard in high-pressure tanks. They also can be fueled with hydrogen-rich fuels; such as methanol, natural gas, or even gasoline; but these fuels must first be converted into hydrogen gas by an onboard device called a "reformer."

FCVs fueled with pure hydrogen emit no pollutants; only water and heat; while those using hydrogen-rich fuels and a reformer produce only small amounts of air pollutants. In addition, FCVs can be twice as efficient as similarly sized conventional vehicles and may also incorporate other advanced technologies to increase efficiency.

Meeting Challenges Together

Before FCVs make it to your local auto dealer, significant research and development is required to reduce cost and improve performance. We must also find effective and efficient ways to produce and store hydrogen and other fuels.

Automakers, fuel cell developers, component suppliers, government agencies, and others are working hard to accelerate the introduction of FCVs. Partnerships such as the DOE-led FreedomCAR initiative and the California Fuel Cell Partnership have been formed to encourage private companies and government agencies to work together to move these vehicles toward commercialization.

FreedomCAR

FreedomCAR is a new cooperative research effort between the DOE and the U.S. Council for Automotive Research (Ford, General Motors, and DaimlerChrysler) formed to promote research into advanced automotive technologies, such as FCVs, that may dramatically reduce oil consumption and environmental impacts. FreedomCAR's goal is the development of cars and trucks that are:

Cheaper to operate
Pollution-free
Competitively priced
Free from imported oil

California Fuel Cell Partnership (CaFCP)

The California Fuel Cell Partnership is a collaboration of auto companies, fuel providers, fuel cell technology companies, and government agencies demonstrating fuel cell electric vehicles in California under day-to-day driving conditions. The goals of the partnership are to test and demonstrate the viability of FCVs and related technology under real-world conditions, move them toward commercialization, and increase public awareness. The Partnership expects to place about 60 FCVs and fuel cell buses on the road by 2003.

The New Music Technology

2009-09-22T09:53:00.000-07:00

Teenagers from across Wiltshire will be will be finding out more about using technology to make their own music over the coming weeks as they take part in week-long courses run as part of an exciting new music project.

MusicXpress is a Music Technology project which aims to give young people from across Wiltshire the chance to DJ and build skills in technology, often for the first time. Funded by Youth Music, The Paul Hamlyn Foundation and the Vodafone UK Foundation, it is run by Wiltshire Youth Arts Partnership (WYAP) and the Wiltshire Music Centre, in partnership with Wiltshire Youth Development Service, Salisbury College and St Laurence School. The 18 month project will offer courses and outreach sessions in Youth Centres in all areas of the county.

Beginning in July, holiday courses take place during school holidays at the Wiltshire Music Centre and Salisbury College. Young people will be able to develop skills in DJing and Music Technology, creating new tracks and lyrics to be burned onto CD. There will also be the opportunity for school leavers or college students to work as peer mentors alongside the music leaders, gaining further training in technology. The Bradford on Avon course runs August 14-18, and the Salisbury course runs from August 29 - September 1. Courses cost just £10 per participant for the week, and help can be offered with travel.

Outreach sessions will be held around the county between now and October 07. Sessions have recently taken place in Malmesbury, Tidworth, Corsham and Durrington Youth Development Centres, with more venues planned for the autumn term.

There are still places available on both the Bradford and Salisbury holiday courses, and anyone interested in booking should contact WYAP
T: 01249 716681.

MusicXpress are actively seeking new venues to host sessions in Autumn 2006 and 2007, and interested youth clubs or youth projects should contact WYAP.

Following a successful pilot project in 2004/05, 'MusicXpress 2' has been made possible by grants totalling £73,500, from Youth Music, The Paul Hamlyn Foundation and the Vodafone UK Foundation.

Your Mileage

2009-09-21T09:09:00.000-07:00

EPA has improved its methods for estimating fuel economy, but your mileage will still vary.

EPA tests are designed reflect "typical" driving conditions and driver behavior, but several factors can affect MPG significantly:

How & Where You Drive
Vehicle Condition & Maintenance
Fuel Variations
Vehicle Variations
Engine Break-In

Therefore, the EPA ratings are a useful tool for comparing the fuel economies of different vehicles but may not accurately predict the average MPG you will get.

To find out what you can do to improve the fuel economy of your car, see Driving More Efficiently and Keeping Your Car in Shape.

The New Face of War

2009-09-18T09:15:00.000-07:00

Negroponte does not apply the bits-for-atoms principle to warfare, but Bruce Berkowitz, in The New Face of War, does. According to Berkowitz, a senior analyst at RAND and a former intelligence officer, future wars will not be won by having more atoms (troops, weapons, territory) than an opponent, but by having more bits . . . of information.

Berkowitz argues that atoms that used to be big winners will become big losers to information technology. Reconnaissance sensors will quickly find massed troops, enabling adversaries to zap those troops with precision-guided weapons. Fortifications will tie armies down to fixed locations, making them sitting ducks for smart bombs. Cheap cyber weapons (e.g., computer viruses) will neutralize expensive kinetic weapons (e.g., missile defenses).

Berkowitz sums up the growing dominance of bits over atoms: “The ability to collect, communicate, process, and protect information is the most important factor defining military power.” The key word here is: “the most important factor.” The New Face of War gives many historical examples of information superiority proving to be an important factor in defining military power, such as the allies breaking German and Japanese codes during World War II and Union forces employing disinformation to mislead Confederates in the Civil War. But the digital revolution has transformed information from supporting actor to leading lady.

Evidence that this revolution has already occurred abounds. In the 1990 Gulf War, smart weapons turned Saddam’s strength (concentrated troops and tanks) into liabilities. More recently, al-Qa’ida used the global telecommunications net to coordinate successful attacks by small, stealthy groups who triumphed through information superiority (knowing more about their targets than their targets knew about them).

Perhaps the biggest effect of information technology on warfare will be the elimination of the concept of a front, according to Berkowitz. If fronts persist at all, they will live in cyberspace where info-warriors battle not over turf, but over control of routers, operating systems, and firewalls. Even so, The New Face of War argues that there will be no electronic “Pearl Harbors” on the emerging battlefield of bits because disabling a nation’s information technology (IT) infrastructure will be too hard even for the most sophisticated cyber-warriors. Well-timed, pinpoint computer network attacks will be much more likely.

Dr. Berkowitz’s vision of the future is probably right in many respects and off target in a few others. But, regardless of its accuracy, his book surfaces critical questions for the Intelligence Community.

First, the things he gets right and what these mean for intelligence: Information technology has changed warfare not by degree, but in kind, so that victory will increasingly go to combatants who maneuver bits faster than their adversaries. Thus, intelligence services will need an increasing proportion of tech-savvy talent to track, target, and defend against adversaries’ IT capabilities. As countries like China, India, Pakistan, and Russia grow their IT talent base—and IT market share—faster than the United States, the strengths of their intelligence services will likely increase relative to those of US intelligence.

Because cyber-wars will be played out on landscapes of commercial IT, intelligence agencies will need new alliances with the private sector, akin to existing relationships between nation states. And the Intelligence Community will have to confront knotty problems such as: performing intelligence preparation of cyber battlefields; assessing capabilities and intentions of adversaries whose info-weapons and defenses are invisible; deciding whether there is any distinction between cyber defense and cyber intelligence; and determining who in the national security establishment should perform functions that straddle the offensive, defensive, and intelligence missions of the uniformed services and intelligence agencies.

The growing importance of IT in warfare will also change the way intelligence agencies support atom-based conflicts. New technology will collect real-time intelligence for fast-changing tactical engagements, but the mainstay product of the Intelligence Community, serialized reports, is far too slow for disseminating these high-tech indications and warnings. Faster means of delivering—and protecting—raw collection must be devised, so that real-time intelligence can be sent directly to shooters without detouring through multiple echelons of military intelligence analysts. Also, remote sensors designed to report on the capabilities, intentions, and activities of armed forces, will not find lone terrorists. Radically new sensing networks that blanket the globe will be needed to collect pinpoint intelligence on individual targets.

The distinction between intelligence and tactical operations data (such as contact reports and significant activity reports) will blur as national intelligence means are focused on real-time tactical missions. All-source analysts will need to add tactical operations reporting to their diet of HUMINT, SIGINT, IMINT, OSINT and MASINT.

Now, the areas in which The New Face of War misses the mark: First, military power in the future will not flow solely from precision zapping and deployment of small, networked forces. Some missions, such as peacekeeping, will always demand the highly visible presence of large forces. And if numbers do not matter anymore, as Berkowitz suggests, why worry about North Korea’s million-plus army? The bottom line is that as intelligence agencies get better at tracking and collecting on individuals terrorists, they will still need robust targeting and force protection capabilities against large conventional forces.

The evolution of media, with which we began this discussion, teaches powerful lessons about the folly of too quickly abandoning the old for the new. The printing press did not abolish handwriting; motion pictures did not kill live theater; television did not doom radio; and the Internet did not extinguish magazines. For each of these transitions from old to new, there were plenty of pundits who prophesized the demise of legacy forms of communication at the hands of new information technology.

Berkowitz is in good company, though. The US Air Force was so sure that close air combat was obsolete, that the first F-4 fighters did not have cannons. They relied instead on high-tech air-to-air missiles—until the F-4s fell victim to the cannons of North Vietnamese MIGs in “obsolete” air combat. Low-tech weapons on the F-4 ultimately did not yield to high-tech missiles; they simply moved over and made room for them. And today’s newest generation of fighters still retain cannons.

There is an important lesson here for intelligence agencies: As novel collection, analytic, and dissemination technologies are acquired, traditional tradecraft should be retained to cope with traditional adversaries and tactical situations. Just as missiles did not replace cannons, legacy tradecraft will need to be preserved but continuously improved to track changes in conventional warfare. For example, imaging satellites will always be essential, but they will have to steadily increase resolution and dwell time. Ditto for traditional SIGINT and MASINT collection systems.

I also disagree with Berkowitz’s contention that there can be no electronic Pearl Harbors. The inexorable migration to the Internet of such diverse functions as telephony, power plant control, commercial data networks, and defense communications has already created a “one-stop-shop” target for info-warriors. In essence, industrialized nations have done in cyberspace what Berkowitz says is so perilous in physical space: namely, concentrated all their eggs in one basket. Intelligence agencies should not, therefore, abandon the hope of severely crippling a cyber enemy, nor should they assume a cyber enemy could not return the favor.

Despite these shortcomings, The New Face of War is an eminently enjoyable read, jam-packed with fascinating historical examples of information technology at war. Dr. Berkowitz’s experience as an intelligence officer comes through clearly in his book, providing important context and relevance for intelligence collectors, analysts, and disseminators.

Put another way, whether consumed as atoms or bits, The New Face of War is a must read for all intelligence professionals.

TED sixth sense technology

2009-09-17T10:20:00.000-07:00

Water Energy Technology Team

2009-09-16T10:25:00.000-07:00

The material welfare of the world's population depends on maintaining access to increasingly scarce water and energy resources. Water and energy in engineered and natural systems are intricately linked.

Extracting raw energy resources, cooling power plants, and powering the generators for hydroelectric energy all use water.

People also use natural waterways to dilute and disperse pollutants.

Extracting, purifying, pumping and transporting drinking water, heating water for domestic and other use, and treating and disposing of wastewater are all activities that use energy. In agricultural and industrial settings, both resources are essential to sustaining economic output.

To minimize resource depletion and maximize human and environmental benefits, it is essential to understand the interdependence of water and energy use.

Super-Hard and Slick Coatings Win R&D 100 Award

2009-09-15T09:57:00.000-07:00

Researchers from the U.S. Department of Energy's (DOE) Argonne National Laboratory received a R&D 100 award, as judged by R&D Magazine, in July 2009 for developing super-hard and slick coating (SSC) for increased engine efficiency and component reliability. SSC is an important step towards increasing fuel efficiency in vehicles, which helps meet the administration's goals of reducing the Nation's dependence on foreign oil and decreasing greenhouse gas emissions.

Argonne National Laboratory (ANL) began researching super slick coatings in 2005. The awards recognize the top scientific and technological innovations of the past year. ANL scientists have won 105 R&D 100 awards since they were first introduced in 1964. The Vehicle Technologies Program has received 20 awards for various technologies created in collaboration with five different laboratories, universities and industry.

Super-hard and slick coatings can improve the performance of all kinds of moving mechanical systems, including engines. Friction, wear, and lubrication strongly affect the energy efficiency, durability, and environmental compatibility of such systems. As an example, frictional losses in an engine may account for 10-20 percent of the total fuel energy (depending on the engine size, type, driving conditions, and weather, for example). The amount of emissions produced by these engines is also strongly related to their fuel economy. In general, the higher the fuel economy, the lower the emissions. In fact, achieving higher fuel economy and lower emissions is one of the most important goals for all industrialized nations. SSC with its self-lubricating and low-friction nature can certainly help to increase the fuel economy of future engines.

The SSC is a designer coating: The ingredients used to make it were predicted by a crystal-chemical model proposed by its developers. In laboratory and engine tests, SSC reduced friction by 80 percent compared to uncoated steel and virtually eliminated wear under severe boundary-lubricated sliding regimes.

Tribology is the science and technology of interacting surfaces in relative motion. Tribological materials in future engine systems will be subjected to much higher thermal and mechanical loads and will be supplied with less effective but more environmentally sound lubricants in much reduced quantities. Energy saving and environmental benefits resulting from the uses of SSC are real. As of 2009, the United States consumes nearly 13 million barrels of oil per day to power motored vehicles. The total energy losses resulting from friction in these vehicles are estimated to account for about 15 percent of the fuel's energy. Therefore, if it can be reduced by one third by advanced friction control technologies like SSC, billions of dollars could be saved every year.

Because SSC allows for less friction in engines, it helps manufacturers produce more fuel-efficient vehicles. This in turn helps Americans save money at the gas pump, and boosts the American auto industry by helping manufacturers produce more appealing cars because of increased fuel efficiency.

Funding for this research was provided by the DOE's Office of Energy Efficiency and Renewable Energy Vehicle Technologies Program. The SSC was jointly developed by a team from Argonne and Istanbul Technical University. Galleon International Co., Brighton, MI, and Hauzer Technocoating, The Netherlands licensed the patents.

Nuclear Medicine Technology

2009-09-14T09:43:00.000-07:00

Definition
Under supervision, prepares, measures, administers radiopharmaceuticals in diagnostic and
therapeutic studies, and performs nuclear medicine procedures on patients of all ages utilizing
various types of imaging equipment.

Distinguishing Characteristics
Nuclear Medicine Technologists perform a wide variety of exacting technical tests and procedures
using radioactive materials and the operation of radiation detection devices. Incumbents receive
supervision from a technical supervisor, but receive direction from a physician who establishes
protocols, reviews procedures, and interprets results.

Typical Tasks
• Perform a full range of nuclear medicine prescribed imaging techniques such as brain, liver,
kidney scans and thyroid activity measurements used in medical diagnosis and evaluation;
• Calibrate and draw up radiopharmaceutical materials and administer it by mouth, injection, or
other means to patients;
• Formulate radiopharmaceutical materials from pre-prepared kits;
• Evaluate recorded images for technical quality;
• Operate cameras that detect and map the radioactive drug in a patient’s body;
• Calculate data to include results of patient studies and radioactive decay;
• Process computerized image data to include function curves and reconstructed SPECT images
and accurately transfer images to the Picture Archive Communication System (PACS);
• Prepare and maintain records concerning radiopharmaceutical receiving, dispensing, and
disposal activities;
• Administer thyroid therapy to patients that have undergone prior clinical and nuclear medicine diagnosis;
• Ensure decay of pharmaceutical and calculate for correct dosage using dose calibrator;
• Observe patient dosage to ensure proper treatment under direct supervision of a radiologist;
• Monitor therapy patient’s room for radioactivity and review room upon discharge;
• Assume care for physical and psychological needs of patients for all ages during examination;
• Schedule patients for exams and explain test procedures, as necessary;
• Initiate life support measures for patient, if necessary;
• Formulate radiopharmaceutical materials from pre-prepared kits;
• Assist in administering therapeutic procedures;
• Research patient chart for evaluation and/or procedure planning;
• Draw blood for diagnostic nuclear medicine tests;
• Calibrate equipment and instruments to maintain quality control standards;
• Calculate the strength of radioactive materials;
• Monitor work areas for radioactivity;
• Clean/store contaminated instruments and gloves;
• Instruct student technologists, residents and physicians in nuclear medicine techniques;
• Accurately bill procedures performed in nuclear medicine;
• Keep informed on new technical developments;
• Maintain inventory of supplies;
• Maintain compliance with radiation safety policies and documentation that keep the radiation
dose to workers and patients as low as reasonably achievable;
• Perform other related duties as required.

Employment Standards
Successful completion of a recognized Nuclear Medicine training program, and certification by the
State of California to practice as a Nuclear Medicine Technologist (CNMT) upon appointment.
Possession of current certification in CPR and Basic Life Support.
Sufficient education, training and experience to demonstrate possession of the knowledge and
abilities listed below.

Knowledge of:
• Principles, procedures, practices, terminology and equipment used throughout the Nuclear
Medicine Department;
• Proper safety precautions and procedures involved in handling specimens, equipment,
instruments and supplies used in nuclear medicine;
• General knowledge of radioactive materials commonly used in a hospital;
• Precautions necessary for patient and staff in use of radioactive materials;
• Phlebotomy techniques;
• Basic computer skills.

Ability to:
• Perform standard diagnostic procedures using radioactive isotopes and to prepare reports
resulting from such procedures;
• Comprehend and carry out technical medical instructions with accuracy;
• Perform required sequences of exacting procedures with accuracy and necessary speed;
• Use and adjust radiation counting equipment;
• Accurately measure extremely small quantities of liquid samples;
• Withdraw blood samples from patients and perform required tests;
• Keep accurate records of receipt, use and disposal of all radioactive materials;
• Troubleshoot, document, and communicate equipment problems;
• Calibrate instruments and equipment;
• Deal with patients sympathetically and tactfully.

ITL Security Bulletins

2009-09-11T09:07:00.000-07:00

ITL Bulletins are published by NIST's Information Technology Laboratory, with most bulletins written by the Computer Security Division. These bulletins are published on the average of six times a year. Each bulletin presents an in-depth discussion of a single topic of significant interest to the information systems community. Not all of ITL Bulletins that are published relate to computer / network security. Only the computer security ITL Bulletins are found here.

Future Trends in Ship Size

2009-09-10T09:00:00.000-07:00

For several years, designs have been available for vessels with capacities of up to about 8700 TEU. The design and construction of such vessels is well within the state of the art. In fact, a consensus among shipbuilders and ship operators is that a container ship able to load 15,000 TEU may well be a possibility. For such a ship to become a viable reality may require a complete rethinking of the way containers are handled to– and from the ship as well as to and from–and within the shoreside terminals.

Although the ship may be technologically feasible, there must be a level of trade sufficient to support such a vessel. Of equal or greater impor- tance, there must be shoreside facilities to match its capacity. The major problem is the need to minimize port time (There is a truism that a transportation asset, whether ship, aircraft, rail car, or truck must be in motion to assure its economic survival) In addition, and of great importance, the harbor waters, berths, and approach channels must be of sufficient depth and the berths themselves must be large enough and properly equipped to handle the larger (longer, wider, and deeper) vessel.

In the case of this mega-container ship, the terminal must have sufficient area to accommodate the larger number of boxes that will accumulate before the ship arrives and as she is being discharged and loaded; crane capacity (in terms of both the number of cranes and their cycle time) must be sufficient to minimize port stays; and, needless to say, the requirements for sufficient water depth and appropriate vessel berths must be considered.

We believe that we have not seen the practicable upper limit of container ship size in the 7000-TEU plus vessels now in existence. An eventual ceiling might be found around the 10,000 to 12,000 TEU level. Market forces will continue to influence the evolution of the system as long as it moves in a way that continues to provide improvements in cost, reliability, and speed and customer satisfaction.

NASA Launches New Technology: An Inflatable Heat Shield

2009-09-09T08:42:00.000-07:00

A successful NASA flight test Monday demonstrated how a spacecraft returning to Earth can use an inflatable heat shield to slow and protect itself as it enters the atmosphere at hypersonic speeds.

The Inflatable Re-entry Vehicle Experiment, or IRVE, was vacuum-packed into a 15-inch diameter payload "shroud" and launched on a small sounding rocket from NASA's Wallops Flight Facility on Wallops Island, Va., at 8:52 a.m. EDT. The 10-foot diameter heat shield, made of several layers of silicone-coated industrial fabric, inflated with nitrogen to a mushroom shape in space several minutes after liftoff.

The Black Brant 9 rocket took approximately four minutes to lift the experiment to an altitude of 131 miles. Less than a minute later it was released from its cover and started inflating on schedule at 124 miles up. The inflation of the shield took less than 90 seconds.

"Our inflation system, which is essentially a glorified scuba tank, worked flawlessly and so did the flexible aeroshell," said Neil Cheatwood, IRVE principal investigator and chief scientist for the Hypersonics Project at NASA's Langley Research Center in Hampton, Va. "We're really excited today because this is the first time anyone has successfully flown an inflatable reentry vehicle."

According to the cameras and sensors on board, the heat shield expanded to its full size and went into a high-speed free fall. The key focus of the research came about six and a half minutes into the flight, at an altitude of about 50 miles, when the aeroshell re-entered Earth's atmosphere and experienced its peak heating and pressure measurements for a period of about 30 seconds.

An on board telemetry system captured data from instruments during the test and broadcast the information to engineers on the ground in real time. The technology demonstrator splashed down and sank in the Atlantic Ocean about 90 miles east of Virginia's Wallops Island.

"This was a small-scale demonstrator," said Mary Beth Wusk, IRVE project manager, based at Langley. "Now that we've proven the concept, we'd like to build more advanced aeroshells capable of handling higher heat rates."

Inflatable heat shields hold promise for future planetary missions, according to researchers. To land more mass on Mars at higher surface elevations, for instance, mission planners need to maximize the drag area of the entry system. The larger the diameter of the aeroshell, the bigger the payload can be.

The Inflatable Re-entry Vehicle Experiment is an example of how NASA is using its aeronautics expertise to support the development of future spacecraft. The Fundamental Aeronautics Program within NASA's Aeronautics Research Mission Directorate in Washington funded the flight experiment as part of its hypersonic research effort.

The Mega-Container Ship

2009-09-08T09:12:00.000-07:00

The definition of the mega-container ship has changed in lock step with the construction of larger and larger vessels. In the mid-1980s, when United States Lines built its “Jumbo Econ” container ships (now owned by Sea-Land as its Atlantic Class), their 4354-TEU capacity was classified in the “mega” region. Today, “mega-container ship” describes only those vessels having a capacity in excess of 6000 TEU and the definition changes as each new generation of vessels is delivered. Around 7700 TEU are carried on today’s mega- carrier, which is about 1138 feet (347 meters) in length–almost a quarter mile, or, in the popular idiom, nearly “four football fields”– and has a beam of 140 feet (42.8 meters). The container stack is 17 wide.

Technology Literacy Challenge Fund

2009-09-07T08:44:00.000-07:00

States, communities, and the private sector face a challenge of massive proportions, in terms of effective innovation and school improvement, as well as in terms of substantial investments and reprioritizing of school budgets. The purpose of the Technology Literacy Challenge Fund is to serve as a catalyst for states, local communities, companies, universities, and individuals to work together on a common set of goals. The president has asked Congress to appropriate $2 billion over five years for the fund. For the fund to succeed, each federal dollar will have to be matched by dollars and in-kind contributions from state, local, and private-sector sources. The president has included the first installment of this fund--$250 million--in his 1997 budget.

The fund would provide states with maximum flexibility. To receive funds, states would have to meet only these basic objectives:

Each state would develop a strategy for enabling every school in the state to meet the four technology goals. These state strategies would address the needs of all schools, from the suburbs to the inner cities to rural areas. Strategies would include benchmarks and timetables for accomplishing the four goals, but these measures would be set by each state, not by the federal government.
State strategies would include significant private-sector participation and commitments, matching at least the amount of federal support. Commitments could be met by volunteer services, cost reductions, and discounts for connections under the expanded Universal Service Fund provisions of the Telecommunications Act of 1996, among other ways.
To ensure accountability, each state not only would have to set benchmarks, but also would be required to report publicly at the end of every school year the progress made in achieving its benchmarks, as well as how it would achieve the ultimate objectives of its strategies in the most cost-effective manner.

By design, states would have tremendous flexibility. Because the states are at different points in financing and using educational technology in the classroom, this flexibility is necessary so each state can address its own particular needs according to a technology plan that it develops itself.

About CAUBE

2009-09-04T08:31:00.000-07:00

CAUBE.AU was formed to represent the views of those in Australia who are opposed to the advertising practices which are collectively known as email spam. Consumers are increasingly hostile to spam, whether it comes from unknown or known senders. CAUBE.AU is an all-volunteer grassroots organisation dedicated to eliminating spam from electronic mail boxes, with a focus on Australia's role in preventing spam. We pursue these aims through community education programs, by providing this site, which is a central repository for information on spam in Australia, and by providing advice to the government on how best to deal with the spam problem.

We have been involved in numerous activities that have improved the regulatory situation in Australia, including activities leading up to the enactment of the Spam Act 2003, consultations on the best practice model for electronic commerce, Parliamentary committee inquiries, and industry code development.

Recognising that the trends in spam volumes clearly demonstrate that spam is a real danger to the value of electronic mail, the Australian Government and the Australian Parliament acted to ban most spam, passing the Spam Bill 2003 in December 2003. This reflects the reality that by its nature, the spam problem cannot be solved without legislation designed to deal with spam. The resulting Spam Act 2003 (Cth) outlaws the vast majority of spam

While we regard legislation as necessary for consumer protection, we also value the role of education. While education cannot address the problem of unrepentant spammers who would happily destroy the Internet if it would earn them a few bucks in change, there are those who spam simply because they are not aware of the destructive nature of that method of advertising. We believe that many of these people, when given a reasonable and balanced representation of the facts, will agree that spam is an inexcusably unethical method of promoting their products.

Monitoring the Work Place

2009-09-03T09:02:00.000-07:00

Some monitoring of staff activities in the workplace may be reasonable to ensure that staff are performing their duties and using resources appropriately. Where the monitoring includes retention of a record of the staff activity e.g. a CCTV video recording or a computer record of emails or a web surfing trail, then the privacy principles in the Privacy Act may apply.

Generally, monitoring of staff's use of email, the internet and other computer resources, where staff have been advised about that monitoring, would be allowed. The Office has issued advisory guidelines on Workplace Email, Web Browsing and Privacy. These recommend steps that organisations can take to ensure that their staff understand the organisation's position on this issue through the development of clear policies.

There are some other laws that deal specifically with the use of surveillance or listening devices. For example the Telecommunications (Interception and Access) Act 1979 (Cth) relates to rules around intercepting telephone communications.

NIST Study Finds a Decade of High-Payoff, High-Throughput Research

2009-09-02T09:26:00.000-07:00

In its first decade of work, a research effort at the National Institute of Standards and Technology (NIST) to develop novel and improved "combinatorial" techniques for polymer research—an effort that became the NIST Combinatorial Methods Center (NCMC)—realized economic benefits of at least $8.55 for every dollar invested by NIST and its industry partners, according to a new economic analysis.

The new study,* conducted for NIST by RTI International, estimates that from inception (1998) through 2007, the investment in the NCMC has yielded a social rate of return of about 161 percent (also known as the "internal rate of return" in corporate finance; a minimum acceptable IRR for a government research project is about 50 percent). RTI’s evaluation also found that the NCMC accelerated industry’s adoption of combinatorial methods by an average of 2.3 years.

RTI surveyed and interviewed polymer scientists at NCMC member institutions, as well as from the much larger body of research universities and chemical companies who benefited from the center’s research and outreach. The study found that the NCMC has had a significant impact on the development and use of combinatorial research methods for polymers and other organic materials, both in the development of novel techniques and data and the diffusion of research results to the larger polymers research community.

Started as a NIST pilot project in 1998 and formally established in 2002, the NCMC was conceived as a community effort—supported by NIST and industry membership fees—to develop methods for discovering and optimizing complex materials such as multicomponent polymer coatings and films, adhesives, personal care products and structural plastics. Indeed, the RTI report lauded the novel "open source" consortium model that NIST developed for the center as a main reason for its success and impact. The program has since branched out into nanostructured materials, organic electronics, and biomaterials.

The big idea behind combinatorial and high-throughput research is to replace traditional, piecemeal approaches to testing new compounds with methods that can synthesize and test large numbers of possible combinations simultaneously and systematically. NIST in particular pioneered the idea of "continuous gradient libraries," polymer test specimens whose properties change gradually and regularly from one side to the other so that the behavior of a huge number of possible mixtures can be evaluated at the same time. (For example, see http://www.nist.gov/public_affairs/techbeat/tb2006_0608.htm#designer "Designer Gradients Speed Surface Science Experiments," NIST Tech Beat, June 8, 2006, and http://www.nist.gov/public_affairs/techbeat/tb2007_0510.htm#wet "Wetter Report: New Approach to Testing Surface Adhesion," NIST Tech Beat, May 10, 2007.)

The NCMC has contributed advances in three major platform infratechnologies for creating combinatorial "libraries" for materials research—gradient thin films, and discrete libraries created by robotic dispensing systems and microfluidics systems—as well as several new high-throughput measurement methods and information technologies to manage the vast amount of data produced by combinatorial analysis. The center's research program is matched with an outreach effort to disseminate research results through open workshops and training programs.

The RTI report, Retrospective Economic Impact Assessment of the NIST Combinatorial Methods Center, is available online at www.nist.gov/director/prog-ofc/report09-1.pdf. The Web home page of the NIST Combinatorial Methods Center is at http://www.nist.gov/msel/polymers/combi.cfm.

NIST Scientists Study How to Stack the Deck for Organic Solar Power

2009-09-01T08:22:00.000-07:00

A new class of economically viable solar power cells - cheap, flexible and easy to make - has come a step closer to reality as a result of recent work* at the National Institute of Standards and Technology (NIST), where scientists have deepened their understanding of the complex organic films at the heart of the devices.

Organic photovoltaics, which rely on organic molecules to capture sunlight and convert it into electricity, are a hot research area because in principle they have significant advantages over traditional rigid silicon cells. Organic photovoltaics start out as a kind of ink that can be applied to flexible surfaces to create solar cell modules that can be spread over large areas as easily as unrolling a carpet. They’d be much cheaper to make and easier to adapt to a wide variety of power applications, but their market share will be limited until the technology improves. Even the best organic photovoltaics convert less than 6 percent of light into electricity and last only a few thousand hours. “The industry believes that if these cells can exceed 10 percent efficiency and 10,000 hours of life, technology adoption will really accelerate,” says NIST’s David Germack. “But to improve them, there is critical need to identify what’s happening in the material, and at this point, we’re only at the beginning.”

The NIST team has advanced that understanding with their latest effort, which provides a powerful new measurement strategy for organic photovoltaics that reveals ways to control how they form. In the most common class of organic photovoltaics, the “ink” is a blend of a polymer that absorbs sunlight, enabling it to give up its electrons, and ball-shaped carbon molecules called fullerenes that collect electrons. When the ink is applied to a surface, the blend hardens into a film that contains a haphazard network of polymers intermixed with fullerene channels. In conventional devices, the polymer network should ideally all reach the bottom of the film while the fullerene channels should ideally all reach the top, so that electricity can flow in the correct direction out of the device. However, if barriers of fullerenes form between the polymers and the bottom edge of the film, the cell’s efficiency will be reduced.

By applying X-ray absorption measurements to the film interfaces, the team discovered that by changing the nature of the electrode surface, it will repulse fullerenes (like oil repulses water) while attracting the polymer. The electrical properties of the interface also change dramatically. The resultant structure gives the light-generated photocurrent more opportunities to reach the proper electrodes and reduces the accumulation of fullerenes at the film bottom, both of which could improve the photovoltaic’s efficiency or lifetime.

“We’ve identified some key parameters needed to optimize what happens at both edges of the film, which means the industry will have a strategy to optimize the cell’s overall performance,” Germack says. “Right now, we’re building on what we’ve learned about the edges to identify what happens throughout the film. This knowledge is really important to help industry figure out how organic cells perform and age so that their life spans will be extended.”

DNA profiling

2009-08-31T09:04:00.000-07:00

Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.

Engineering Sciences

2009-08-28T08:14:00.000-07:00

Computational fluid dynamics, Interface science and engineering, Development of speciality chemicals, Advanced materials, Surface technology, Laser materials processing, Smart sensors and materials, Transducer and sensor technology, Very large scale integrated (VLSI) system design, Embedded systems, Signal processing technologies, Micro-instrumentation/Nano-instrumentation, Microelectro- mechanical systems (MEMS) and Nano-electro-mechanical systems (NEMS), Microfabrication/ Micromachining and Nanotechnology, Multi-criteria decision making including genetic algorithms and neural networks, Optical information processing and optical computation, Quantum computing, Wireless communication/computing, Virtual reality, Internet techniques, E-commerce, Machine intelligence, Robotics and automation, Intelligent manufacturing, Recycling in manufacturing, Computer integrated manufacturing, Manufacturing process simulation, Advanced production technologies, Advanced mechanical design, Mechatronics, Fuel cells, Thermal engineering, Magnetics (magnetostriction, giant-, colossal- and tunneling- magneto-resistance, magneto-fluidics, magneto-refrigeration), Advanced characterization techniques, Bio-mechanics, Smart structures/earthquake engineering, Textile technology.

Characteristics of Digital Information

2009-08-27T10:56:00.000-07:00

In the reference scenario, the student is seeking information (content) on beavers--a kind of animal. All information on the Internet is represented in bits--electronic strings of 1's and 0's that are later interpreted according to some algorithm to produce a representation that is meaningful to human beings. Digital information has properties very different from those of the information that a student might retrieve in a book. For purposes of this report, the salient aspects of this digital representation of information are the following:

Reproducible. Unlike a physical book or photograph or analog audio recording, a digital information object can be copied infinitely many times, often without losing any fidelity or quality.

Easily shared. Because information is easily copied, it is also easy to distribute at low cost. Digital information can be shared more easily than any type of analog information in the past. In the physical world, broadcasting information to groups has serious costs and hence requires a certain wherewithal and commitment. Technologies such as e-mail and Web sites allow broadcasting to many people at the touch of a single button.

Flexible. A variety of different types of information can be represented digitally: images, movies, text, sound. Digital information can even be used to control movement in the physical world through digitally controlled actuators.

Easily modified. Digital representations of information can be easily manipulated. It is trivial to modify an image--say, changing hair color from blond to red, adding a few notes to a musical score, or deleting and adding text to a document. So, for example, a naked body can be affixed to a head of a child, words modified from their original intent and music "borrowed" freely, and even virtual "people" created, all without leaving a visible trace of these manipulations.

Difficult to intercept. Because no physical object is necessarily associated with a digital information object, interdiction of digital information is much more difficult than interdiction of a physical object carrying information. In other words, there is no book, no magazine, no photo that can be intercepted by physical means.

Advanced Combustion Engines

2009-08-26T09:39:00.000-07:00

Although internal combustion engines have been used for more than a century, significant improvements in energy efficiency and emissions reduction are still possible. Because of their relatively low cost, high performance, and ability to use renewable fuels (e.g. ethanol and biodiesel), conventional vehicles with combustion engines will likely dominate the market for at least the next 20 years. The United States can cut its transportation fuel use 20%–40% through commercialization of advanced engines—resulting in greater economic, environmental, and energy security. As hybrids and plug-in hybrids become cost competitive and gain market share, employing advanced combustion engines in these vehicles will enable even greater fuel savings.

The Advanced Combustion Engine R&D subprogram of the U.S. Department of Energy's Vehicle Technologies Program (VTP) is improving the fuel economy of passenger vehicles (cars and light trucks) and commercial vehicles (medium-duty and commercial trucks) by increasing the efficiency of the engines that power them. Work is done in collaboration with industry, national laboratories, and universities, as well as in conjunction with the FreedomCAR and Fuels Partnership for passenger vehicle applications and the 21st Century Truck Partnership for commercial vehicle applications.

Nuclear Medicine Technologists

2009-08-25T08:50:00.000-07:00

Significant Points

Two-thirds of nuclear medicine technologists worked in hospitals.
Nuclear medicine technology programs range in length from 1 to 4 years and lead to a certificate, an associate degree, or a bachelor’s degree.
Faster-than-average job growth will arise from an increase in the number of middle-aged and elderly persons, who are the primary users of diagnostic and treatment procedures.
The number of job openings each year will be relatively low because the occupation is small; technologists who also are trained in other diagnostic methods, such as radiologic technology or diagnostic medical sonography, will have the best prospects.

Tubular Solid Oxide Fuel Cell Technology

2009-08-24T09:15:00.000-07:00

Solid oxide fuel cells differ in many respects from other fuel cell technologies. First, they are composed of all-solid-state materials--the anode, cathode and electrolyte are all made from ceramic substances. Second, because of the all-ceramic make-up, the cells can operate at temperatures as high as 1,800 degrees F (1,000 degrees C), significantly hotter than any other major category of fuel cell. This produces exhaust gases at temperatures ideal for use in combined heat and power applications and combined-cycle electric power plants. Third, the cells can be configured either as rolled tubes (tubular) or as flat plates (planar) and manufactured using many of the techniques now employed today by the electronics industry.

Although a variety of oxide combinations have been used for solid oxide electrolytes, the most common has been doping zirconia with yttria, which serves to facilitate the transport of oxygen ions. Formed as a crystal lattice, the hard ceramic electrolyte tube is coated on both sides with specialized porous electrode materials.

At the high operating temperatures, oxygen ions are formed from air in the interior of the tubes at the "air electrode" (the cathode). When a fuel gas containing hydrogen is passed over the outside of the tube in contact with the "fuel electrode" (the anode), the oxygen ions migrate through the crystal lattice to oxidize the fuel. Electrons generated at the anode move out through an external circuit, creating electricity. Reforming natural gas or other hydrocarbon fuels to extract the necessary hydrogen can be accomplished within the fuel cell, eliminating the need for an external reformer. The tubular design also eliminates the need for seals and allows for thermal expansion. The tubular stacks are cooled using process air, and during normal operation consume no external water.

The fuel-to-electricity efficiencies of solid oxide fuel cells are expected to be around 50 percent. If the hot exhaust of the cells is used in a hybrid combination with gas turbines, the electrical generating efficiency might exceed 70 percent. In applications designed to capture and utilize the system's waste heat, overall fuel use efficiencies could top 80-85 percent.

The technical roots of solid oxide technology extend as far back as the late 1930s when Swiss scientist Emil Bauer and his colleague H. Preis experimented with zirconium, yttrium, cerium, lanthanum, and tungsten as electrolytes. By the late 1950s, Westinghouse began experimenting with zirconium compounds and small-scale research into solid oxide fuel cells was being carried out by researchers in the Netherlands, and the Consolidation Coal Company in Pennsylvania, and General Electric in New York. Much of the research, however, was short-lived as melting, short-circuiting, and high electrical resistance inside the cell materials created numerous technical hurdles.

One company, Westinghouse Electric Corporation continued to develop tubular solid oxide fuel cells, and in 1962 one of the first federal research contracts by the newly-formed Office of Coal Research in the Department of the Interior was granted to Westinghouse to study a fuel cell using zirconium oxide and calcium oxide. By 1976, the Energy Research and Development Administration--one of DOE's predecessor agencies--embarked upon an R&D program with Westinghouse to develop tubular solid oxide fuel cells.

Throughout the 1980s Westinghouse experimented with the design of tubular SOFCs, starting with very short cells built on a porous support tube (PST). Stacks and systems were also demonstrated, starting with a 400-Watt stack sponsored by the Tennessee Valley Authority (TVA). In the late 1990s, Siemens AG Power Generation purchased the power generation business unit of Westinghouse.

In the 1990s, long cell lifetimes and commercially viable cell performance were established, air electrode supported (AES) cells were developed that eliminated the PST, and a new cooperative agreement with the DOE was initiated to commercialize tubular SOFCs. The turn of the century culminated in the current successful commercial prototype 150 cm cells, and a 100 kW cogeneration system that operated in the Netherlands, Italy, and Germany for more than 36,000 hours. Also, a world record for individual fuel cell operation (~8 years) still stands, and the prototype 150 cm cells have demonstrated two critical successes: the ability to withstand >100 thermal cycles and voltage degradation of less than 0.1 percent per 1,000 hours.

Today, Siemens Power Generation has gone beyond the tubular technology to develop new high power density and high active area SOFCs under the SECA Program (the HPD Delta SOFC).

Fuel Cell/Turbine Hybrids

The high-temperature operation of a solid oxide fuel cell and its capability to operate at elevated pressures makes it an attractive candidate for linking with a gas turbine in a hybrid configuration. The hot, high pressure exhaust of the fuel cell can be used to spin a gas turbine, generating an additional source of electricity.

Siemens has tested the world's first solid oxide fuel cell/gas turbine hybrid system. The system had a total output of 220 kW, with 200 kW from the fuel cell and 20 kW from the microturbine generator. This proof-of-concept system demonstrated an electrical efficiency of 53 percent.

New Technology and Youth Violence

2009-08-21T08:26:00.000-07:00

Young people are using new media technology, including cell phones, personal data assistants, and the Internet, to communicate with others in the United States and throughout the world. New communication avenues, such as text messaging, chat rooms, and social networking websites (e.g., MySpace and Facebook), have allowed youth to easily develop relationships, some with people they have never met in person.

New technology has many potential benefits for youth. It allows young people to communicate with family and friends on a regular basis. New technology also provides opportunities to make rewarding social connections for those teens and pre-teens who have difficulty developing friendships in traditional social settings or because of limited contact with same-aged peers. In addition, regular Internet access allows young people to quickly increase their knowledge on a wide variety of topics.

However, the recent explosion in technology does not come without possible risks. Youth can use electronic media to embarrass, harass or threaten their peers. Increasing numbers of teens and pre-teens are becoming victims of this new form of violence. Although many different terms-such as cyberbullying, Internet harassment, and Internet bullying-have been used to describe this type of violence, electronic aggression is the term that most accurately captures all types of violence that occur electronically. Like traditional forms of youth violence, electronic aggression is associated with emotional distress and conduct problems at school.

In September 2006, the Centers for Disease Control and Prevention (CDC) convened a panel of experts to discuss issues related to the emerging public health problem of electronic aggression. The panel included representatives from research universities, public school systems, federal agencies, and nonprofit organizations. A special issue of the Journal of Adolescent Health summarizes the data and recommendations from this expert panel meeting.

Solar Energy Systems

2009-08-20T08:49:00.000-07:00

Pursuant to the scope of India-EU Science and Technology Cooperation Agreement & Reinforcing the international dimension of European research within the European Commission's Seventh Framework of Research , the 2009 India-EU Call on Solar Energy System will facilitate India-EU Project mode partnerships supported by two-way mobility of researchers with a view to :

Catalyzing emergence of solar power as an economically viable, commercially attractive, environment friendly and sustainable energy option;
Advancing the transition to clean energy technologies (such conversion of solar radiation into electricity using ST,CSP/SPV) ) that are sustainable, affordable ,add to energy security and have no adverse impact on climate;
Building institutional tie-ups with EU partners to incubate feasibility of and/or scaling up of research, pilot scale production and creation of new knowledge with output in the form of joint patents and co-authored publications;
Achieving cost reduction , higher efficiency & reliability of solar photovoltaic devices and systems;

Improving design ,fabrication and demonstration of innovative solar thermal power generating technology .

Solar Energy Research Initiative

2009-08-19T09:32:00.000-07:00

A pan IIT coordinated programme on Solar Energy Research has been initiated to synergise strengths of IITs in the area of Solar Energy Research both thermal as well as photovoltaic. The programme would also attempt to demonstrate hybrid solar-agro energy systems for distributed energy generation to establish viability of the system to meet rural energy needs. A prototype solar thermal stand alone power plant will be mobilised under public- private- partnership mode which would encourage indigenous research and ingenuity in integration of sub-systems and exploration of various R&D pathways and multiple technology alternatives. A task force has been set up to guide DST's efforts in the area of Solar Energy Research.

Engine Research

2009-08-18T09:28:00.000-07:00

EPA's engine research focuses on developing engines that are simultaneously clean, efficient, and cost effective, and which have high potential to produce real-world benefits.

Clean Diesel Combustion technology is one example of these innovative engine concepts. EPA's testing suggests the potential for a diesel engine design, using innovative air, fuel, and combustion management and conventional particulate matter aftertreatment, to achieve lower NOx levels without the need for NOx aftertreatment. EPA is developing this technology as a potential alternative with other diesel emissions control approaches (e.g., NOx adsorbers, urea selective catalytic reduction (SCR), etc.). Clean Diesel Combustion technology shows the potential to meet NOx levels "engine-out" over the entire engine operating range, to a level required for future diesel emissions standards. EPA has partnered with several automotive and engine manufacturers to evaluate the production feasibility of this technology. Using clean diesel combustion technology in conjunction with the full hydraulic drive is projected to improve fuel economy more than using either technology alone.

Fact Sheet: Clean Diesel Combustion -- Clean, Efficient, and Cost Effective Technology
Presentation and speaker's notes: A Path to More Sustainable Transportation presentation includes an update on an EPA diesel combustion technology that meets the 2007 heavy duty standards with engine-out NOx emissions of less than 0.2 gm/BHP/hr without the need for any NOx aftertreatment.
Presentation on SAE Paper 2004-01-0933: An HCCI Engine Power Plant for a Hybrid Vehicle . This presentation describes work conducted at the National Vehicle and Fuel Emissions Laboratory to explore the potential use of a homogenous charge compression ignition (HCCI) as a power plant for a hybrid vehicle.

Can Digital TV Reception be Affected by Moving Vehicles and Weather?

2009-08-17T08:32:00.000-07:00

Your DTV reception can be affected by nearby moving vehicles, such as cars, trucks, trains and airplanes. In some instances, shadowing or reflections from these vehicles may cause your digital picture to temporarily break-up or even disappear completely. If this occurs, you should try moving or reorienting your antenna to find a position that provides the most reliable reception. If you are using an indoor antenna, switching to an outdoor antenna system which may include a directional antenna or rotor could improve reception. In severe cases it may not be possible to completely eliminate the effect of nearby traffic. If reception remains unsatisfactory due to these disruptions, viewers may wish to consider alternatives such as cable or satellite service.

Your DTV reception can also be affected by severe weather conditions such as storms and high winds. These reception issues can result from fluctuations in the broadcast signal that can be caused, for example, by moving leaves and branches on trees. You can minimize the effects of high winds or storms by re-orienting your antenna to obtain the strongest available signal. If this does not work, a better indoor antenna or an outdoor antenna may help. In addition, make sure that outdoor antenna mounts are secure to minimize any movement caused by the wind. If you lose reception of a particular channel during severe weather conditions try tuning to other channels that remain available for weather advisory information or alerts. In cases where no TV stations can be received, you should tune to a local AM or FM station or any other available media for weather alerts.

How VoIP / Internet Voice Works

2009-08-14T08:49:00.000-07:00

VoIP services convert your voice into a digital signal that travels over the Internet. If you are calling a regular phone number, the signal is converted to a regular telephone signal before it reaches the destination. VoIP can allow you to make a call directly from a computer, a special VoIP phone, or a traditional phone connected to a special adapter. In addition, wireless "hot spots" in locations such as airports, parks, and cafes allow you to connect to the Internet and may enable you to use VoIP service wirelessly.

IP-Enabled Services

2009-08-13T09:26:00.000-07:00

Voice over Internet Protocol (VoIP), is a technology that allows you to make voice calls using a broadband Internet connection instead of a regular (or analog) phone line. Some VoIP services may only allow you to call other people using the same service, but others may allow you to call anyone who has a telephone number - including local, long distance, mobile, and international numbers. Also, while some VoIP services only work over your computer or a special VoIP phone, other services allow you to use a traditional phone connected to a VoIP adapter.

Launching Rockets

2009-08-12T11:02:00.000-07:00

NASA to build a new Inductrack model at Lawrence Livermore to demonstrate the concept at speeds up to Mach 0.5 (170 meters per second). NASA is interested in maglev technology to help launch rockets at sharply reduced costs. As conceived, a track would use a reusable launcher to propel a rocket up a ramp to almost Mach 1 speeds before the rocket's main engines fire. According to Smith, the technology should be able to save about 30% of the weight of the launch vehicle. "Rocket engines are not fuel-efficient at low speed," he points out.

The Livermore team is designing a 150-meter-long track, to be built at the Laboratory site, on which a scaled launch cradle and rocket will be accelerated. Unlike the present track, the one for NASA will interleave powered drive coils with passive levitation coils to reach the required speeds. The team is partnered with computer scientists at Pennsylvania State University, who are developing an integrated design code that includes magnetics, aerodynamics, stresses, and control stability to assess full-scale systems.

Post believes Inductrack offers NASA the potential for a far less expensive technology for magnetic levitation launchers than approaches using superconducting coils. He and Smith note, however, that while the existing Inductrack model has demonstrated the principle of the concept, there are new issues to be addressed in launching rockets. Among these are high g forces, sustained speeds of Mach 0.5 or higher, the effects of fluctuating aerodynamic forces on the launching cradle and its payload, and aerodynamic and other issues associated with detachment and flight of rockets.

New Computer Technology Dissolves Limitations to Traditional Design and Engineering Methods

2009-08-11T09:42:00.000-07:00

Traditional design and engineering constraints are being overcome with a new computer/robotics technology developed jointly by Sandia National Laboratories and Deneb Robotics, Inc. of Auburn Hills, Mich.

The Virtual Collaborative Engineering (VCE) technology allows engineers, technicians and operators to collaborate from widely disparate locations on designs, simulations and robotic operations. With VCE, researchers can develop new robot control algorithms to validate models developed in their university labs without owning a robot; designers can access machining centers to fabricate prototypi-cal parts; and manufacturers can model, simulate and measure the performance of prospective robotic tools before purchasing them.

The ability to collaborate remotely reduces travel time and expense, and speeds up the time it takes to bring new products to market.

Development of the technology was driven by Sandia's search for solutions to clean up hazard-ous waste sites and a push to keep national manufacturing competitive.

"Hazardous waste cleanup requires systems that not only retrieve waste, but monitor its condition, ensure environmental and personal safety, meet changing legal and regulatory requirements, and are affordable. Our objective was to reduce the operational costs and to increase the efficiency and safety of clean-up operations," said Michael McDonald of Sandia's Intelligent Systems Dept. "VCE gives us the ability to do this work remotely with robots and to address all these issues. We can bring together all the nuclear, robotic, design and engineering experts, from wherever they are, and work interactively to develop ways to approach specific situations.

"Whether we need to remediate waste, develop new robot systems for manufacturing, or pre-view and simulate a new factory system, we can do it safely, efficiently and economically with VCE technology," McDonald added.

Sandia's Laboratory Directed Research & Development (LDRD) program, the Department of Energy's Robotics Technology Development Project (RTDP), and other internal Sandia programs such as TIE-In, which provides on-line access to Sandia technologies, collaborated on the development of VCE technology. RTDP is promoting VCE applications development, particularly in the area of Graphical Programming Technology, by teaming with university, industry and government sectors, and serving as a bridge to speed the implementation of VCE into practical engineering solutions.

Sandia is working with Deneb to commercialize VCE technologies, which when combined with Sandia-developed robotic controls technologies, will allow engineers, technicians, and operators to collaborate on projects.

VCE is a significant step beyond teleconferencing.

"Our implementation of VCE allows all of the engineers at disparate locations to communicate using the same dataset," said Jay P. Harrison, Deneb's senior vice president of research and technology. "VCE is truly interactive since it allows each participant to manipulate the full 3-D environment and actually run the simulation. Any collaborator can request the master token, stop the simulation and show the others an aspect of the design or manufacturing operation where a problem will occur. No other tool has ever offered that capability."

Working with Sandia, Deneb added VCE capability to its TELE-interactive Graphics Robot Instructional Program (TELEGRIP), a simulation-based control system for the development and im-plementation of robots with integrated sensors, graphic representation, real-time reasoning and elec-tromechanical systems. The program is designed for hazardous or complex environments in which specific conditions may be unknown or likely to change when executing robot operations.

Sandia and the National Institute of Standards and Technology (NIST) demonstrated VCE's initial capabilities last spring at the Third Annual National Manufacturing Technology Conference at NIST headquarters in Gaithersburg, Md. A geometric model of an experimental, high-precision machining tool was loaded onto workstations at Sandia and at NIST. Engineers at both sites ran control simulation programs interactively on the machining tool. Actions initiated by either engineer were transmitted immediately to both workstations, allowing them to cooperatively interact with the simu-lated machining tool, modify its motions and see results despite being 2000 miles apart.

"This demonstration is a good example of the value of industry and government teaming," McDonald said. "Together, Sandia and Deneb cost-effectively developed and deployed technologies that would be prohibitively expensive for any single organization to produce."

Deneb's President Robert Brown predicts the VCE technology will have a large impact on Department of Defense contractors, the aerospace and automotive industries, manufacturing and research institutions.

"In the aerospace industry, the prime contractor and many first-tier and second-tier subsuppliers need to coordinate product development, product design, manufacturing processes, design for assembly and design for manufacturability," Brown said.

Deneb Robotics, founded in 1985, is a world leader in 3-D graphics-based factory simulation, telerobotic, and virtual reality software. Deneb's simulation and telerobotic software is widely used in the aerospace, automotive, defense, environmental, medical, nuclear, and research communities.

Sandia National Laboratories is a multiprogram Department of Energy laboratory, operated by a subsidiary of Lockheed Martin Corp. With main facilities located in Albuquerque, N.M., and Liver-more, Calif., Sandia has broad-based research and development programs contributing to national de-fense, energy and environmental technologies, and economic competitiveness.

New York City Wireless Network Is Operational Citywide

2009-08-10T09:50:00.000-07:00

In a historic milestone for municipal first responder communications, the New York City Department of Information Technology and Telecommunications (DoITT) and Northrop Grumman Corporation today announced that the New York City Wireless Network (NYCWiN) is operational citywide. NYCWiN is a high-speed, mobile data network representing the most aggressive commitment by any municipality in the United States to provide a next-generation public safety infrastructure. The network is now operational across New York City's more than 300 square miles and exceeds requirements for coverage and data throughput speed.

"With Northrop Grumman, we have worked to deploy a network and capabilities that will propel New York City into the 21st century," said DoITT Commissioner Paul J. Cosgrave. "NYCWiN will provide robust, reliable and resilient data communications, enhancing coordination and ensuring that critical information reaches our mobile workforce, to the benefit of all City agencies and the people we serve. We are pleased to have worked collaboratively on this significant and transformative initiative with Northrop Grumman, which has proven itself in the field of public safety communications."

NYCWiN provides first responders high-speed data access to support large file transfers, including fingerprints, mug shots, City maps, automatic vehicle location, and full-motion streaming video. A fully-interoperable, IP-based network, NYCWiN enhances coordination by linking first responder personnel, on-scene, wirelessly with incident managers at remote sites through real-time data and video feeds.

"The development of NYCWiN represents a major accomplishment and opportunity to transform the way New York City government operates, by improving the capabilities and efficiency of public safety and service agencies" said Tom Shelman, vice president and general manager of Northrop Grumman Information Systems' Civil Systems Division. "NYCWiN is a model for how states, cities, and counties can deploy and manage their own mission-critical communications infrastructure."

For example, DoITT and the New York City Police Department (NYPD) are now working toward the installation of wireless modems in 1,800 marked patrol fleet vehicles, which will enable officers in the field to access critical applications via NYCWiN previously available only from their desktops - mobile access to mug shots and moving traffic violations information being prime examples.

"The NYCWiN technology platform provides data transfer speeds 100 times that of our legacy networks and enables us to deploy a wealth of broadband applications - including streaming video to increase situational awareness among our first responders," said Steve Harte, DoITT's Associate Commissioner of Wireless Technologies. "Leveraging this capability, we have also created an interoperable video management system (IVS) that allows the New York City Mayor's Office, NYPD, Fire Department, Office of Emergency Management, and a variety of other agencies to access shared, incident-based video feeds as needed."

Recent examples of IVS deployment include Operation Safe PATH 2009 - a full-scale, multi-agency exercise to test the City's and the Port Authority's response to an Improvised Explosive Device (IED) detonation on a New Jersey-bound Port Authority Trans-Hudson (PATH) train - and US Airways Flight 1549, which ditched into the Hudson River last January. In each case the IVS was mobilized at the incident scene, enabling first responder command units to stream video back to the City's Emergency Operations Centers.

NYCWiN can also be leveraged by City agencies to improve service delivery to New Yorkers. Automated water meter reading, traffic signal control and myriad handheld inspectional programs are now planned or underway, allowing New York City's mobile workforce to not only to function more efficiently, but also to realize substantial cost savings across participating agencies.

Working with partner Grey Island, Northrop Grumman is also helping the City deploy an automated vehicle location system in nearly 400 vehicles across more than a dozen City agencies. This effort will help meet Mayor Bloomberg's PlaNYC goals for improved sustainability by decreasing vehicle usage, improving gas consumption, and providing real-time management of the City's vehicle fleet.

To enable these and other high-speed mobile applications, DoITT, Northrop Grumman and IPWireless deployed NYCWiN's extensive communications infrastructure across the City's more than 300 square miles, covering all five boroughs of New York City. In addition to building the system, Northrop Grumman manages day-to-day network operations, including management of 24-hour network operations centers.

Commissioner Cosgrave continued: "While implementation of NYCWiN represents a substantial public safety and infrastructure achievement, it also illustrates how New York City is transforming itself into a mobile virtual organization. By deploying new wireless applications, we will enhance service delivery to New Yorkers, improve the efficiency of City operations, and raise the bar for the administration of municipal government."

DoITT transforms the way New York City interacts with its residents, businesses, visitors and employees by leveraging technology to improve services and increase transparency, accountability and accessibility across all agencies. In 2006, DoITT awarded Northrop Grumman a five-year contract to implement the New York City Wireless Network, the nation's most comprehensive, high-performance mobile broadband infrastructure.

Northrop Grumman Corporation (NYSE: NOC) is a leading global security company whose 120,000 employees provide innovative systems, products, and solutions in aerospace, electronics, information systems, shipbuilding and technical services to government and commercial customers worldwide.

How War Will Be Fought in the 21st Century

2009-08-07T09:29:00.000-07:00

Nicholas Negroponte, head of MIT’s Media Lab, observed that the information age is fast replacing atoms with bits; movies on film with packets on the Internet; print media with digital media; and wires with digital radio waves.

Negroponte does not apply the bits-for-atoms principle to warfare, but Bruce Berkowitz, in The New Face of War, does. According to Berkowitz, a senior analyst at RAND and a former intelligence officer, future wars will not be won by having more atoms (troops, weapons, territory) than an opponent, but by having more bits . . . of information.

Berkowitz argues that atoms that used to be big winners will become big losers to information technology. Reconnaissance sensors will quickly find massed troops, enabling adversaries to zap those troops with precision-guided weapons. Fortifications will tie armies down to fixed locations, making them sitting ducks for smart bombs. Cheap cyber weapons (e.g., computer viruses) will neutralize expensive kinetic weapons (e.g., missile defenses).

Berkowitz sums up the growing dominance of bits over atoms: “The ability to collect, communicate, process, and protect information is the most important factor defining military power.” The key word here is: “the most important factor.” The New Face of War gives many historical examples of information superiority proving to be an important factor in defining military power, such as the allies breaking German and Japanese codes during World War II and Union forces employing disinformation to mislead Confederates in the Civil War. But the digital revolution has transformed information from supporting actor to leading lady.

Evidence that this revolution has already occurred abounds. In the 1990 Gulf War, smart weapons turned Saddam’s strength (concentrated troops and tanks) into liabilities. More recently, al-Qa’ida used the global telecommunications net to coordinate successful attacks by small, stealthy groups who triumphed through information superiority (knowing more about their targets than their targets knew about them).

Perhaps the biggest effect of information technology on warfare will be the elimination of the concept of a front, according to Berkowitz. If fronts persist at all, they will live in cyberspace where info-warriors battle not over turf, but over control of routers, operating systems, and firewalls. Even so, The New Face of War argues that there will be no electronic “Pearl Harbors” on the emerging battlefield of bits because disabling a nation’s information technology (IT) infrastructure will be too hard even for the most sophisticated cyber-warriors. Well-timed, pinpoint computer network attacks will be much more likely.

Dr. Berkowitz’s vision of the future is probably right in many respects and off target in a few others. But, regardless of its accuracy, his book surfaces critical questions for the Intelligence Community.

First, the things he gets right and what these mean for intelligence: Information technology has changed warfare not by degree, but in kind, so that victory will increasingly go to combatants who maneuver bits faster than their adversaries. Thus, intelligence services will need an increasing proportion of tech-savvy talent to track, target, and defend against adversaries’ IT capabilities. As countries like China, India, Pakistan, and Russia grow their IT talent base—and IT market share—faster than the United States, the strengths of their intelligence services will likely increase relative to those of US intelligence.

Because cyber-wars will be played out on landscapes of commercial IT, intelligence agencies will need new alliances with the private sector, akin to existing relationships between nation states. And the Intelligence Community will have to confront knotty problems such as: performing intelligence preparation of cyber battlefields; assessing capabilities and intentions of adversaries whose info-weapons and defenses are invisible; deciding whether there is any distinction between cyber defense and cyber intelligence; and determining who in the national security establishment should perform functions that straddle the offensive, defensive, and intelligence missions of the uniformed services and intelligence agencies.

The growing importance of IT in warfare will also change the way intelligence agencies support atom-based conflicts. New technology will collect real-time intelligence for fast-changing tactical engagements, but the mainstay product of the Intelligence Community, serialized reports, is far too slow for disseminating these high-tech indications and warnings. Faster means of delivering—and protecting—raw collection must be devised, so that real-time intelligence can be sent directly to shooters without detouring through multiple echelons of military intelligence analysts. Also, remote sensors designed to report on the capabilities, intentions, and activities of armed forces, will not find lone terrorists. Radically new sensing networks that blanket the globe will be needed to collect pinpoint intelligence on individual targets.

The distinction between intelligence and tactical operations data (such as contact reports and significant activity reports) will blur as national intelligence means are focused on real-time tactical missions. All-source analysts will need to add tactical operations reporting to their diet of HUMINT, SIGINT, IMINT, OSINT and MASINT.

Now, the areas in which The New Face of War misses the mark: First, military power in the future will not flow solely from precision zapping and deployment of small, networked forces. Some missions, such as peacekeeping, will always demand the highly visible presence of large forces. And if numbers do not matter anymore, as Berkowitz suggests, why worry about North Korea’s million-plus army? The bottom line is that as intelligence agencies get better at tracking and collecting on individuals terrorists, they will still need robust targeting and force protection capabilities against large conventional forces.

The evolution of media, with which we began this discussion, teaches powerful lessons about the folly of too quickly abandoning the old for the new. The printing press did not abolish handwriting; motion pictures did not kill live theater; television did not doom radio; and the Internet did not extinguish magazines. For each of these transitions from old to new, there were plenty of pundits who prophesized the demise of legacy forms of communication at the hands of new information technology.

Berkowitz is in good company, though. The US Air Force was so sure that close air combat was obsolete, that the first F-4 fighters did not have cannons. They relied instead on high-tech air-to-air missiles—until the F-4s fell victim to the cannons of North Vietnamese MIGs in “obsolete” air combat. Low-tech weapons on the F-4 ultimately did not yield to high-tech missiles; they simply moved over and made room for them. And today’s newest generation of fighters still retain cannons.

There is an important lesson here for intelligence agencies: As novel collection, analytic, and dissemination technologies are acquired, traditional tradecraft should be retained to cope with traditional adversaries and tactical situations. Just as missiles did not replace cannons, legacy tradecraft will need to be preserved but continuously improved to track changes in conventional warfare. For example, imaging satellites will always be essential, but they will have to steadily increase resolution and dwell time. Ditto for traditional SIGINT and MASINT collection systems.

I also disagree with Berkowitz’s contention that there can be no electronic Pearl Harbors. The inexorable migration to the Internet of such diverse functions as telephony, power plant control, commercial data networks, and defense communications has already created a “one-stop-shop” target for info-warriors. In essence, industrialized nations have done in cyberspace what Berkowitz says is so perilous in physical space: namely, concentrated all their eggs in one basket. Intelligence agencies should not, therefore, abandon the hope of severely crippling a cyber enemy, nor should they assume a cyber enemy could not return the favor.

Despite these shortcomings, The New Face of War is an eminently enjoyable read, jam-packed with fascinating historical examples of information technology at war. Dr. Berkowitz’s experience as an intelligence officer comes through clearly in his book, providing important context and relevance for intelligence collectors, analysts, and disseminators.

Five Steps To Better Online Privacy

2009-08-06T09:23:00.000-07:00

5 steps to better online privacy

1. Only conduct business, visit sites or become involved with web sites that have adequate privacy policies that cover at least:

To whom your information will be passed onto
Why the information is being collected
How the information will be used
How you can access information the organisation holds about you

2. Install and use privacy enhancing software including:

Firewall
Cookie Remover
Web Bug Remover
Anonymous Web Browsing
Encrypted Email
Advertising Filters
Anti-Spam Tools
Anti-Spyware Tools
Further Information

3. Opt out of all further contact with the organisation when filling in forms unless you know you want to be in further contact with it

4. Only give as much personal information as you are comfortable with

5. Use an online identity and free email service to protect against giving out your details to spammers

Microsoft Unleashes Natal Project (2009)

2009-08-05T10:05:00.000-07:00

New General Permits For Storm Water Construction, Coal Mining Wastewater Discharges

2009-08-04T09:47:00.001-07:00

The Kentucky Department for Environmental Protection (DEP) has issued new general permits for storm water discharges associated with construction activity and for wastewater discharges associated with coal mining activities within the Commonwealth of Kentucky. The permits go into effect Aug. 1, 2009.

The storm water general permit requires all construction site operators engaged in clearing, grading and excavating activities that disturb one acre or more of land to obtain permit coverage under the National Pollutant Discharge Elimination System (NPDES) for their construction storm water discharges. Conditions of the permit include compliance with approved erosion/sediment control and storm water management plans, self-monitoring and record keeping.

The storm water permits are implemented based on best management practices (BMPs) such as diversion, detention, erosion control, sediment traps, gravel construction entrances, covered storage, spill response, stream buffer zones and good housekeeping. Permittees are required to conduct inspections weekly and the day after any rainfall event resulting in runoff. They must also maintain on-site copies of written inspection reports and any associated enforcement actions.

Persons seeking storm water general permit coverage must file a Notice of Intent (NOI) to discharge either electronically or on paper. NOIs submitted electronically will be processed within seven days of receipt and paper NOIs within 30 days.

The Division of Compliance Assistance and DOW will offer four half-day training sessions in August to provide an overview of the new permit requirements. Visit http://www.dca.ky.gov/Training-Events/ for the dates and locations and to register.

The coal general permit authorizes discharges from coal-mining activities. The permit protects waters of the Commonwealth by requiring technology and water-quality-based effluent limitations and other protective practices, such as the implementation of a BMP plan. The division coordinated with the U.S. Environmental Protection Agency in the development of this permit to address recent actions related to coal mining taken at the federal level.

The coal general permit is not available to those intending to discharge to waters that are impaired by contaminants related to coal mining, for mines discharging within five miles upstream of a public water supply, or for discharges to publicly owned lakes, outstanding state resource waters, outstanding national resource waters or waters classified as cold-water aquatic habitats. An individual Kentucky Pollutant Discharge Elimination System permit must be applied for in those situations.

Who will Control Information Technology by 2010?

2009-07-31T10:38:00.000-07:00

EDITOR: During the next three to five years, the international Internet system will evolve to the new IPV6 protocol standard, which will provide a quantum leap in comprehensive Internet capabilities. This will affect defense, economic prosperity, communications and sharing of information within nations and internationally, as well as daily household integration of hi tech systems. The current IPV4 system was developed and funded entirely by the United States Government and US private companies Whoever leads the development and deployment of IPV6 will, in fact, have a dominant role in being the architect and "toll keeper" of the rapidly growing international information superhighway.

The national security and economic stability of the United States has been based on control of the first generation of Internet communication technologies. Today, Asian countries have surpassed the United States in development and use of the next generation of Internet Protocol. Although Japan, Korea and Europe have joined with the United States in International Summits to set new Internet standards, China is secretly and substantially developing its own IPV6 infrastructure and solutions.

Beijing is taking advantage of technologies and investment from America and its allies. The concern of international economists, human rights advocates and defense experts is that Beijing will use its political and economic leverage in many areas of the developing world to eventually dominate new Internet standards, imbued with the repressive nature of its own non-democratic regime. In addition, whoever controls the distribution of the technologies related to the IPV6 will have the ability to monitor and block information, disrupt communications and, in a time of conflict, shut down entire IT systems vital to a nation's economy and defense.

IPV6, THE NEW INTERNET: The dominant edge of America's economic, communications and military leadership is based on a national investment made 50 years ago to create what became today's global Internet communications systems. At a June 28, 2005 testimony before the U.S. House of Representatives Committee on Government Reform, Alex Lightman, CEO of IPV6 Summit, stated, “...some $9 trillion out of America's $13 million economy is related to IT services, subscriptions and transactions... It is also responsible for the creation of millions of American jobs... And it is the backbone of thousands of products and services vital to the national defense and homeland security systems.”

Today, the US Government is investing a mere fraction of what Japan, Korea, China and Europe are investing into developing the New Internet IPV6 protocol. Each nation's IT standards reflect their own political and economic priorities. A repressive government's priorities are ultimately in contradiction with democratic openness necessary for international peace and prosperity. Thus far, the Defense Department is the only US federal agency showing incentive in New Internet competitiveness. But DOD, worn down by interventions in the Middle East and elsewhere, has a mere fraction of the funding needed to maintain an edge over America's competitors and adversaries.

CHINA's INTERNET LEAP FORWARD: Since 1994, China has emerged from practically no public Internet usage to become the world's second largest [after the United States] Internet population. Within two years, in 2007, China is expected to pass Japan as the world's largest IPV6 user. Meanwhile, the US Internet market is dominated by the rapidly out-of- date IPV4 standard model. IPV6 is increasingly dominant in Japan and Korea. Meanwhile, non- democratic China has refused to join a global coalition. Instead, Beijing is quietly and steady developing hardware and software in preparing to take the lead in providing IPV6, not only for its own economic and military modernization but also to protect the Communist Party's repressive dominance against its own citizens. Beijing can also use its political and economic leverage and advances in Internet censorship to protect dictators in developing countries across the world. More critically, as a component of “asymmetrical” electronic warfare, a country whose companies control and manage IPV6 technology can shut down entire IT systems.

THE CENSORSHIP "GOLDEN SHIELD" China has effectively "sanitized" its domestic Internet through extensive sophisticated on-line monitoring and censorship systems. This has been done with the willing assistance of high-profile US companies who seek greater play in the Chinese Government controlled market. Harvard University's Berkman Center for Internet and Society reports that China's Internet censorship regime is "the most sophisticated in the world." An Amnesty International investigation found that through early 2005, at least 54 persons were imprisoned for distributing "illegal" information through the Net.

A new Chinese Government high-tech surveillance project called "Golden Shield," has been under development for the past five years. US companies have flaunted the post-Tiananmen Square Massacre law that bans selling "crime control and detection" equipment to China, writes Anne Applebaum in the July 21, 2005 Washington Post. According to numerous press reports, American companies like Yahoo have signed a "public pledge of self-discipline" to abide by China Net censorship regime. Cisco Systems has reportedly sold technologies to Chinese internal security agencies that block admission to Web sites unfavorable to China's ruling minority, as well as certain material on sites otherwise accessible. And reportedly, Microsoft has altered the Chinese version of its blog tool, MSN Spaces, at the insistence of Communist information censors. The Orwellian collaboration between US companies and China's Internet censors can dramatically alter IPV6 standards and significantly degrade the free flow of information essential for international peace and prosperity.

Method of Suppressing Errors in Many Types of Quantum Computers

2009-07-30T10:31:00.000-07:00

Researchers at the National Institute of Standards and Technology (NIST) have demonstrated a technique for efficiently suppressing errors in quantum computers. The advance could eventually make it much easier to build useful versions of these potentially powerful but highly fragile machines, which theoretically could solve important problems that are intractable using today’s computers.

The new error-suppression method, described in the April 23 issue of Nature,* was demonstrated using an array of about 1,000 ultracold beryllium ions (electrically charged atoms) trapped by electric and magnetic fields. Each ion can act as a quantum bit (qubit) for storing information in a quantum computer. These ions form neatly ordered crystals, similar to arrays of qubits being fabricated by other researchers using semiconducting and superconducting circuitry. Arrays like this potentially could be used as multi-bit quantum memories.

The new NIST technique counteracts a major threat to the reliability of quantum memories: the potential for small disturbances, such as stray electric or magnetic fields, to create random errors in the qubits. The NIST team applied customized sequences of microwave pulses to reverse the accumulation of such random errors in all qubits simultaneously.

“Simulations show that under appropriate conditions this method can reduce the error rate in quantum computing systems up to a hundred times more than comparable techniques. Our measurement results validate these predictions,” says Hermann Uys, a NIST guest researcher who is a lead author of the paper. Uys is visiting from the Council for Scientific and Industrial Research, Pretoria, South Africa.

Co-lead author Michael J. Biercuk, a NIST post-doc, notes that correcting qubit errors after they occur will require extraordinary resources, whereas early suppression of errors is far more efficient, and improves the performance of subsequent error correction. The new NIST error-suppression method could enable quantum computers of various designs to achieve error rates far below the so-called fault-tolerance threshold of about 1 error in 10,000 computational operations (0.01 percent), Biercuk says. If error rates can be reduced below this level, building a useful quantum computer becomes considerably more realistic.

Quantum computers, by relying on the unusual properties of the atomic-scale world to store and process data, could someday break commonly used encryption codes, perform faster searches of enormous databases, and determine the most efficient schedules for everything from airlines to traveling salespeople. They could also simulate complex quantum systems that are too difficult to study using today’s computers or through direct experiments. But first, practical quantum computers need to be built, and their components need to be reliable.

Unlike today’s computers, which use transistors that are switched on or off to represent bit values of 1 or 0, quantum computers would manipulate the properties of qubits to represent 1 or 0 or—thanks to the peculiarities of the quantum world—both at the same time. But these “quantum states” are so delicate that qubit values would be highly susceptible to errors caused by the slightest electronic noise.

Under ideal conditions, and in the absence of deliberate manipulations, ion qubit states evolve in a predictable way, similar to a spinning top tipped from its vertical axis. Environmental interference can lead to a buildup of error, but the new NIST pulse method can reverse this accumulation, thus preserving the original state.

The NIST method is an adaptation of “spin echo” techniques used for decades to suppress errors in nuclear magnetic resonance (the basis of magnetic resonance imaging). In spin echo, evenly spaced control pulses will nearly reverse the buildup of error, as long as fluctuations are slow relative to the time between pulses.

Recently, scientists at another institution published a theory of how to modify pulse timing in order to improve noise suppression. The NIST team conducted the first experimental demonstration of this theory, and then extended these ideas by generating novel pulse sequences tailored to the ambient noise environment. These novel sequences can be found quickly through an experimental feedback technique, and were shown to significantly outperform other sequences without the need for any knowledge of the noise characteristics. The researchers tested these pulse sequences under realistic noise conditions simulating those appropriate for different qubit technologies, making their results broadly applicable.

The research was conducted in the laboratory of NIST physicist John J. Bollinger, the project lead, and funded in part by the Intelligence Advanced Research Projects Activity.

NIST and the World Trade Center

2009-07-29T10:39:00.000-07:00

The collapse of New York City’s World Trade Center structures following the terrorist attacks of Sept. 11, 2001, was the worst building disaster in recorded history, killing some 2,800 people. More than 350 fire and emergency responders were among those killed, the largest loss of life for this group in a single incident.

In response to the WTC tragedy, the National Institute of Standards and Technology conducted a 3-year building and fire safety investigation to study the factors contributing to the probable cause (or causes) of post-impact collapse of the WTC Towers (WTC 1 and 2) and WTC 7; expanded its research in areas of high-priority need such as prevention of progressive collapse, fire resistance design and retrofit of structures, and fire resistive coatings for structural steel; and is reaching out to the building and fire safety communities to pave the way for timely, expedited considerations of recommendations stemming from the investigation.

Technology Advances to Whole-Carcass Imaging System by Fecal Detection

2009-07-28T10:26:00.000-07:00

Microbiologists Tom Casey (left) and Mark Rasmussen evaluate a new laser for use in their fecal contamination detection system for meat carcasses. They are working in the laser lab of an Iowa State University collaborator, photochemist Jacob Petrich.

Dangerous bacteria such as E. coli O157:H7 are being spotlighted because Agricultural Research Service researchers in partnership with eMerge Interactive, Inc., of Sebastian, Fla., have further developed and tested commercial designs of a fecal detection system capable of scanning an entire beef carcass.

The device can help the meatpacking industry supply safe food products to U.S. and foreign consumers. In a recent trial of an eMerge prototype at the Food and Agricultural Products Research and Technology Center at Oklahoma State University, the detection system revealed trace levels of contamination that were invisible to the human eye, prior to and after trimming. The prototype was also successful in evaluating fecal decontamination on carcasses subjected to levels of high- temperature steam from steam vacuums or steam cabinets. This is a common practice used for microbial intervention in the beef slaughter industry.

The fecal detection technology was developed and patented by ARS scientists Thomas A. Casey and Mark A. Rasmussen, in collaboration with Iowa State University chemist Jacob W. Petrich. It has been exclusively licensed by eMerge and is being further developed under a cooperative research and development agreement.

Research and development engineers at eMerge have developed this technology into new prototypes that scan an entire side of beef for fecal contamination. This improves the technology's practicality for the beef packing industry.

USDA's Food Safety and Inspection Service has a zero-tolerance standard for visible fecal contamination on livestock and poultry carcasses. Visual inspection and carcass cleaning are the standard tools for reducing the potential for E. coli and other bacterial contaminants in slaughterhouses across the country. But the human eye is not sensitive enough to identify all of the fecal contamination that can occur on carcasses, according to Casey, who works with Rasmussen at the ARS National Animal Disease Center in Ames, Iowa. ARS is the U.S. Department of Agriculture's chief scientific research agency.

Cell phone test with water

2009-07-27T10:06:00.000-07:00

Water Primrose Species

2009-07-24T10:15:00.000-07:00

General Information

Water primroses are non-native perennial herbs found creeping along the shoreline, floating on the water surface, or growing upright. They are robust plants with bright yellow, showy flowers and willow-like leaves. They are non-native species originally from South America that have been introduced into Europe and North America. In Washington, L. hexapetala has established in the drainage ditches in the Longview/Kelso area of southwestern Washington. King County weed staff also discovered small populations of this species and also L. peploides in King County. We speculate that at one time, nurseries sold these species in Washington as aquatic garden plants. These species are very invasive and aggressive and form very dense mats of vegetation. Washington lists L. hexapetala as a Class B noxious weed and L. peploides as a Class A noxious weed. The Washington Department of Agriculture lists both species on its quarantine list that prohibits their sale, trade, or transport in Washington.

Growth Habit

These non-native primrose species grow in dense mats along shorelines and out into the water. They favor the margins of lakes, ponds, ditches, and streams. They bloom throughout the summer. This photograph shows L. hexapetala growing along a ditch bank in Longview. Both species reproduce by seeds and by plant fragments.

Management

The Longview Diking District uses mechanical methods to remove water primrose and other noxious plants from the canals and ditches in Longview/Kelso. Other methods such as cutting, covering with opaque materials, and using the aquatic herbicide (Rodeo®) may be effective. It is unlikely that grass carp would find water primroses palatable.

Identification

You can identify non-native water primrose species by their sprawling growth habit and showy yellow flowers.

Look for the following characteristics

Bright, yellow flowers; normally with 5 petals
Alternately-arranged, slightly hairy, willow-like leaves
Dense sprawling, tangled mat of vegetation

Skin diseases in workers at a perfume factory

2009-07-24T09:11:00.000-07:00

The aim of this study is to find out the causes of skin diseases in one-third of the staff of a perfume factory, in which 10 different perfume sprays were being manufactured. Site inspection, dermatological examination and patch testing of all 26 persons at risk with 4 perfume oils and 30 ingredients of them. The results showed 6 bottlers were found suffering from allergic contact dermatitis, 2 from irritant contact dermatitis, 12 workers showed different strong reactions to various fragrances. The main causes of allergic contact dermatitis were 2 perfume oils (12 cases) and their ingredients geraniol (12 cases), benzaldehyde(9), cinnamic aldehyde (6), linalool, neroli oil, terpenes of lemon oil and orange oil (4 each). Nobody was tested positive to balsam of Peru. Job changes for office workers, packers or printers to other rooms, where they had no longer contact with fragrances, led to a settling. To conclude, automation and replacement of glass bottles by cartridges from non-fragile materials and using gloves may minimize the risk.

Quick Facts About Spyware

2009-07-23T09:05:00.000-07:00

Spyware is software installed on your computer without your consent to monitor or control your computer use. Clues that spyware is on a computer may include a barrage of pop-ups, a browser that takes you to sites you don't want, unexpected toolbars or icons on your computer screen, keys that don't work, random error messages, and sluggish performance when opening programs or saving files. In some cases, there may be no symptoms at all.

To lower your risk of spyware infections:

Update your operating system and Web browser software, and set your browser security high enough to detect unauthorized downloads.
Use anti-virus and anti-spyware software, as well as a firewall, and update them all regularly.
Download free software only from sites you know and trust. Enticing free software downloads frequently bundle other software, including spyware.
Don't click on links inside pop-ups.
Don't click on links in spam or pop-ups that claim to offer anti-spyware software; you may unintentionally be installing spyware.

How to avoid phishing scams

2009-07-22T09:12:00.000-07:00

To avoid phishing scams:

Don't reply to an email, text, or pop-up message that asks for personal or financial information, and don't click on links in the message. If you want to go to a bank or business's website, type the web address into your browser yourself.
Don't respond if you get a message – by email, text, pop-up or phone – that asks you to call a phone number to update your account or give your personal information to access a refund. If you need to reach an organization with which you do business, call the number on your financial statement, or use a telephone directory

Some identity thieves have stolen personal information from many people at once, by hacking into large databases managed by businesses or government agencies. While you can't enjoy the benefits of the Internet without sharing some personal information, you can take steps to share only with organizations you know and trust. Don't give out your personal information unless you first find out how it's going to be used and how it will be protected.

If you are shopping online, don't provide your personal or financial information through a company's website until you have checked for indicators that the site is secure, like a lock icon on the browser's status bar or a website URL that begins "https:" (the "s" stands for "secure"). Unfortunately, no indicator is foolproof; some scammers have forged security icons. And some hackers have managed to breach sites that took appropriate security precautions.

Read website privacy policies. They should explain what personal information the website collects, how the information is used, and whether it is provided to third parties. The privacy policy also should tell you whether you have the right to see what information the website has about you and what security measures the company takes to protect your information. If you don't see a privacy policy — or if you can't understand it — consider doing business elsewhere.