DNA profiling

Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.

Engineering Sciences

Computational fluid dynamics, Interface science and engineering, Development of speciality chemicals, Advanced materials, Surface technology, Laser materials processing, Smart sensors and materials, Transducer and sensor technology, Very large scale integrated (VLSI) system design, Embedded systems, Signal processing technologies, Micro-instrumentation/Nano-instrumentation, Microelectro- mechanical systems (MEMS) and Nano-electro-mechanical systems (NEMS), Microfabrication/ Micromachining and Nanotechnology, Multi-criteria decision making including genetic algorithms and neural networks, Optical information processing and optical computation, Quantum computing, Wireless communication/computing, Virtual reality, Internet techniques, E-commerce, Machine intelligence, Robotics and automation, Intelligent manufacturing, Recycling in manufacturing, Computer integrated manufacturing, Manufacturing process simulation, Advanced production technologies, Advanced mechanical design, Mechatronics, Fuel cells, Thermal engineering, Magnetics (magnetostriction, giant-, colossal- and tunneling- magneto-resistance, magneto-fluidics, magneto-refrigeration), Advanced characterization techniques, Bio-mechanics, Smart structures/earthquake engineering, Textile technology.

Characteristics of Digital Information

In the reference scenario, the student is seeking information (content) on beavers--a kind of animal. All information on the Internet is represented in bits--electronic strings of 1's and 0's that are later interpreted according to some algorithm to produce a representation that is meaningful to human beings. Digital information has properties very different from those of the information that a student might retrieve in a book. For purposes of this report, the salient aspects of this digital representation of information are the following:

• Reproducible. Unlike a physical book or photograph or analog audio recording, a digital information object can be copied infinitely many times, often without losing any fidelity or quality.
• Easily shared. Because information is easily copied, it is also easy to distribute at low cost. Digital information can be shared more easily than any type of analog information in the past. In the physical world, broadcasting information to groups has serious costs and hence requires a certain wherewithal and commitment. Technologies such as e-mail and Web sites allow broadcasting to many people at the touch of a single button.
• Flexible. A variety of different types of information can be represented digitally: images, movies, text, sound. Digital information can even be used to control movement in the physical world through digitally controlled actuators.
• Easily modified. Digital representations of information can be easily manipulated. It is trivial to modify an image--say, changing hair color from blond to red, adding a few notes to a musical score, or deleting and adding text to a document. So, for example, a naked body can be affixed to a head of a child, words modified from their original intent and music "borrowed" freely, and even virtual "people" created, all without leaving a visible trace of these manipulations.
• Difficult to intercept. Because no physical object is necessarily associated with a digital information object, interdiction of digital information is much more difficult than interdiction of a physical object carrying information. In other words, there is no book, no magazine, no photo that can be intercepted by physical means.

Advanced Combustion Engines

Although internal combustion engines have been used for more than a century, significant improvements in energy efficiency and emissions reduction are still possible. Because of their relatively low cost, high performance, and ability to use renewable fuels (e.g. ethanol and biodiesel), conventional vehicles with combustion engines will likely dominate the market for at least the next 20 years. The United States can cut its transportation fuel use 20%–40% through commercialization of advanced engines—resulting in greater economic, environmental, and energy security. As hybrids and plug-in hybrids become cost competitive and gain market share, employing advanced combustion engines in these vehicles will enable even greater fuel savings.

The Advanced Combustion Engine R&D subprogram of the U.S. Department of Energy's Vehicle Technologies Program (VTP) is improving the fuel economy of passenger vehicles (cars and light trucks) and commercial vehicles (medium-duty and commercial trucks) by increasing the efficiency of the engines that power them. Work is done in collaboration with industry, national laboratories, and universities, as well as in conjunction with the FreedomCAR and Fuels Partnership for passenger vehicle applications and the 21st Century Truck Partnership for commercial vehicle applications.

Nuclear Medicine Technologists

Significant Points

• Two-thirds of nuclear medicine technologists worked in hospitals.
• Nuclear medicine technology programs range in length from 1 to 4 years and lead to a certificate, an associate degree, or a bachelor’s degree.
• Faster-than-average job growth will arise from an increase in the number of middle-aged and elderly persons, who are the primary users of diagnostic and treatment procedures.
• The number of job openings each year will be relatively low because the occupation is small; technologists who also are trained in other diagnostic methods, such as radiologic technology or diagnostic medical sonography, will have the best prospects.

Tubular Solid Oxide Fuel Cell Technology

Solid oxide fuel cells differ in many respects from other fuel cell technologies. First, they are composed of all-solid-state materials--the anode, cathode and electrolyte are all made from ceramic substances. Second, because of the all-ceramic make-up, the cells can operate at temperatures as high as 1,800 degrees F (1,000 degrees C), significantly hotter than any other major category of fuel cell. This produces exhaust gases at temperatures ideal for use in combined heat and power applications and combined-cycle electric power plants. Third, the cells can be configured either as rolled tubes (tubular) or as flat plates (planar) and manufactured using many of the techniques now employed today by the electronics industry.

Although a variety of oxide combinations have been used for solid oxide electrolytes, the most common has been doping zirconia with yttria, which serves to facilitate the transport of oxygen ions. Formed as a crystal lattice, the hard ceramic electrolyte tube is coated on both sides with specialized porous electrode materials.

At the high operating temperatures, oxygen ions are formed from air in the interior of the tubes at the "air electrode" (the cathode). When a fuel gas containing hydrogen is passed over the outside of the tube in contact with the "fuel electrode" (the anode), the oxygen ions migrate through the crystal lattice to oxidize the fuel. Electrons generated at the anode move out through an external circuit, creating electricity. Reforming natural gas or other hydrocarbon fuels to extract the necessary hydrogen can be accomplished within the fuel cell, eliminating the need for an external reformer. The tubular design also eliminates the need for seals and allows for thermal expansion. The tubular stacks are cooled using process air, and during normal operation consume no external water.

The fuel-to-electricity efficiencies of solid oxide fuel cells are expected to be around 50 percent. If the hot exhaust of the cells is used in a hybrid combination with gas turbines, the electrical generating efficiency might exceed 70 percent. In applications designed to capture and utilize the system's waste heat, overall fuel use efficiencies could top 80-85 percent.

The technical roots of solid oxide technology extend as far back as the late 1930s when Swiss scientist Emil Bauer and his colleague H. Preis experimented with zirconium, yttrium, cerium, lanthanum, and tungsten as electrolytes. By the late 1950s, Westinghouse began experimenting with zirconium compounds and small-scale research into solid oxide fuel cells was being carried out by researchers in the Netherlands, and the Consolidation Coal Company in Pennsylvania, and General Electric in New York. Much of the research, however, was short-lived as melting, short-circuiting, and high electrical resistance inside the cell materials created numerous technical hurdles.

One company, Westinghouse Electric Corporation continued to develop tubular solid oxide fuel cells, and in 1962 one of the first federal research contracts by the newly-formed Office of Coal Research in the Department of the Interior was granted to Westinghouse to study a fuel cell using zirconium oxide and calcium oxide. By 1976, the Energy Research and Development Administration--one of DOE's predecessor agencies--embarked upon an R&D program with Westinghouse to develop tubular solid oxide fuel cells.

Throughout the 1980s Westinghouse experimented with the design of tubular SOFCs, starting with very short cells built on a porous support tube (PST). Stacks and systems were also demonstrated, starting with a 400-Watt stack sponsored by the Tennessee Valley Authority (TVA). In the late 1990s, Siemens AG Power Generation purchased the power generation business unit of Westinghouse.

In the 1990s, long cell lifetimes and commercially viable cell performance were established, air electrode supported (AES) cells were developed that eliminated the PST, and a new cooperative agreement with the DOE was initiated to commercialize tubular SOFCs. The turn of the century culminated in the current successful commercial prototype 150 cm cells, and a 100 kW cogeneration system that operated in the Netherlands, Italy, and Germany for more than 36,000 hours. Also, a world record for individual fuel cell operation (~8 years) still stands, and the prototype 150 cm cells have demonstrated two critical successes: the ability to withstand >100 thermal cycles and voltage degradation of less than 0.1 percent per 1,000 hours.

Today, Siemens Power Generation has gone beyond the tubular technology to develop new high power density and high active area SOFCs under the SECA Program (the HPD Delta SOFC).

Fuel Cell/Turbine Hybrids

The high-temperature operation of a solid oxide fuel cell and its capability to operate at elevated pressures makes it an attractive candidate for linking with a gas turbine in a hybrid configuration. The hot, high pressure exhaust of the fuel cell can be used to spin a gas turbine, generating an additional source of electricity.

Siemens has tested the world's first solid oxide fuel cell/gas turbine hybrid system. The system had a total output of 220 kW, with 200 kW from the fuel cell and 20 kW from the microturbine generator. This proof-of-concept system demonstrated an electrical efficiency of 53 percent.

New Technology and Youth Violence

Young people are using new media technology, including cell phones, personal data assistants, and the Internet, to communicate with others in the United States and throughout the world. New communication avenues, such as text messaging, chat rooms, and social networking websites (e.g., MySpace and Facebook), have allowed youth to easily develop relationships, some with people they have never met in person.

New technology has many potential benefits for youth. It allows young people to communicate with family and friends on a regular basis. New technology also provides opportunities to make rewarding social connections for those teens and pre-teens who have difficulty developing friendships in traditional social settings or because of limited contact with same-aged peers. In addition, regular Internet access allows young people to quickly increase their knowledge on a wide variety of topics.

However, the recent explosion in technology does not come without possible risks. Youth can use electronic media to embarrass, harass or threaten their peers. Increasing numbers of teens and pre-teens are becoming victims of this new form of violence. Although many different terms-such as cyberbullying, Internet harassment, and Internet bullying-have been used to describe this type of violence, electronic aggression is the term that most accurately captures all types of violence that occur electronically. Like traditional forms of youth violence, electronic aggression is associated with emotional distress and conduct problems at school.

In September 2006, the Centers for Disease Control and Prevention (CDC) convened a panel of experts to discuss issues related to the emerging public health problem of electronic aggression. The panel included representatives from research universities, public school systems, federal agencies, and nonprofit organizations. A special issue of the Journal of Adolescent Health summarizes the data and recommendations from this expert panel meeting.

Solar Energy Systems

Pursuant to the scope of India-EU Science and Technology Cooperation Agreement & Reinforcing the international dimension of European research within the European Commission's Seventh Framework of Research , the 2009 India-EU Call on Solar Energy System will facilitate India-EU Project mode partnerships supported by two-way mobility of researchers with a view to :

• Catalyzing emergence of solar power as an economically viable, commercially attractive, environment friendly and sustainable energy option;
• Advancing the transition to clean energy technologies (such conversion of solar radiation into electricity using ST,CSP/SPV) ) that are sustainable, affordable ,add to energy security and have no adverse impact on climate;
• Building institutional tie-ups with EU partners to incubate feasibility of and/or scaling up of research, pilot scale production and creation of new knowledge with output in the form of joint patents and co-authored publications;
• Achieving cost reduction , higher efficiency & reliability of solar photovoltaic devices and systems;

Improving design ,fabrication and demonstration of innovative solar thermal power generating technology .

Solar Energy Research Initiative

A pan IIT coordinated programme on Solar Energy Research has been initiated to synergise strengths of IITs in the area of Solar Energy Research both thermal as well as photovoltaic. The programme would also attempt to demonstrate hybrid solar-agro energy systems for distributed energy generation to establish viability of the system to meet rural energy needs. A prototype solar thermal stand alone power plant will be mobilised under public- private- partnership mode which would encourage indigenous research and ingenuity in integration of sub-systems and exploration of various R&D pathways and multiple technology alternatives. A task force has been set up to guide DST's efforts in the area of Solar Energy Research.

Engine Research

EPA's engine research focuses on developing engines that are simultaneously clean, efficient, and cost effective, and which have high potential to produce real-world benefits.

Clean Diesel Combustion technology is one example of these innovative engine concepts. EPA's testing suggests the potential for a diesel engine design, using innovative air, fuel, and combustion management and conventional particulate matter aftertreatment, to achieve lower NOx levels without the need for NOx aftertreatment. EPA is developing this technology as a potential alternative with other diesel emissions control approaches (e.g., NOx adsorbers, urea selective catalytic reduction (SCR), etc.). Clean Diesel Combustion technology shows the potential to meet NOx levels "engine-out" over the entire engine operating range, to a level required for future diesel emissions standards. EPA has partnered with several automotive and engine manufacturers to evaluate the production feasibility of this technology. Using clean diesel combustion technology in conjunction with the full hydraulic drive is projected to improve fuel economy more than using either technology alone.

• Fact Sheet: Clean Diesel Combustion -- Clean, Efficient, and Cost Effective Technology
• Presentation and speaker's notes: A Path to More Sustainable Transportation presentation includes an update on an EPA diesel combustion technology that meets the 2007 heavy duty standards with engine-out NOx emissions of less than 0.2 gm/BHP/hr without the need for any NOx aftertreatment.
• Presentation on SAE Paper 2004-01-0933: An HCCI Engine Power Plant for a Hybrid Vehicle . This presentation describes work conducted at the National Vehicle and Fuel Emissions Laboratory to explore the potential use of a homogenous charge compression ignition (HCCI) as a power plant for a hybrid vehicle.

Can Digital TV Reception be Affected by Moving Vehicles and Weather?

Your DTV reception can be affected by nearby moving vehicles, such as cars, trucks, trains and airplanes. In some instances, shadowing or reflections from these vehicles may cause your digital picture to temporarily break-up or even disappear completely. If this occurs, you should try moving or reorienting your antenna to find a position that provides the most reliable reception. If you are using an indoor antenna, switching to an outdoor antenna system which may include a directional antenna or rotor could improve reception. In severe cases it may not be possible to completely eliminate the effect of nearby traffic. If reception remains unsatisfactory due to these disruptions, viewers may wish to consider alternatives such as cable or satellite service.

Your DTV reception can also be affected by severe weather conditions such as storms and high winds. These reception issues can result from fluctuations in the broadcast signal that can be caused, for example, by moving leaves and branches on trees. You can minimize the effects of high winds or storms by re-orienting your antenna to obtain the strongest available signal. If this does not work, a better indoor antenna or an outdoor antenna may help. In addition, make sure that outdoor antenna mounts are secure to minimize any movement caused by the wind. If you lose reception of a particular channel during severe weather conditions try tuning to other channels that remain available for weather advisory information or alerts. In cases where no TV stations can be received, you should tune to a local AM or FM station or any other available media for weather alerts.

How VoIP / Internet Voice Works

VoIP services convert your voice into a digital signal that travels over the Internet. If you are calling a regular phone number, the signal is converted to a regular telephone signal before it reaches the destination. VoIP can allow you to make a call directly from a computer, a special VoIP phone, or a traditional phone connected to a special adapter. In addition, wireless "hot spots" in locations such as airports, parks, and cafes allow you to connect to the Internet and may enable you to use VoIP service wirelessly.

IP-Enabled Services

Voice over Internet Protocol (VoIP), is a technology that allows you to make voice calls using a broadband Internet connection instead of a regular (or analog) phone line. Some VoIP services may only allow you to call other people using the same service, but others may allow you to call anyone who has a telephone number - including local, long distance, mobile, and international numbers. Also, while some VoIP services only work over your computer or a special VoIP phone, other services allow you to use a traditional phone connected to a VoIP adapter.

Launching Rockets

NASA to build a new Inductrack model at Lawrence Livermore to demonstrate the concept at speeds up to Mach 0.5 (170 meters per second). NASA is interested in maglev technology to help launch rockets at sharply reduced costs. As conceived, a track would use a reusable launcher to propel a rocket up a ramp to almost Mach 1 speeds before the rocket's main engines fire. According to Smith, the technology should be able to save about 30% of the weight of the launch vehicle. "Rocket engines are not fuel-efficient at low speed," he points out.

The Livermore team is designing a 150-meter-long track, to be built at the Laboratory site, on which a scaled launch cradle and rocket will be accelerated. Unlike the present track, the one for NASA will interleave powered drive coils with passive levitation coils to reach the required speeds. The team is partnered with computer scientists at Pennsylvania State University, who are developing an integrated design code that includes magnetics, aerodynamics, stresses, and control stability to assess full-scale systems.

Post believes Inductrack offers NASA the potential for a far less expensive technology for magnetic levitation launchers than approaches using superconducting coils. He and Smith note, however, that while the existing Inductrack model has demonstrated the principle of the concept, there are new issues to be addressed in launching rockets. Among these are high g forces, sustained speeds of Mach 0.5 or higher, the effects of fluctuating aerodynamic forces on the launching cradle and its payload, and aerodynamic and other issues associated with detachment and flight of rockets.

New Computer Technology Dissolves Limitations to Traditional Design and Engineering Methods

Traditional design and engineering constraints are being overcome with a new computer/robotics technology developed jointly by Sandia National Laboratories and Deneb Robotics, Inc. of Auburn Hills, Mich.

The Virtual Collaborative Engineering (VCE) technology allows engineers, technicians and operators to collaborate from widely disparate locations on designs, simulations and robotic operations. With VCE, researchers can develop new robot control algorithms to validate models developed in their university labs without owning a robot; designers can access machining centers to fabricate prototypi-cal parts; and manufacturers can model, simulate and measure the performance of prospective robotic tools before purchasing them.

The ability to collaborate remotely reduces travel time and expense, and speeds up the time it takes to bring new products to market.

Development of the technology was driven by Sandia's search for solutions to clean up hazard-ous waste sites and a push to keep national manufacturing competitive.

"Hazardous waste cleanup requires systems that not only retrieve waste, but monitor its condition, ensure environmental and personal safety, meet changing legal and regulatory requirements, and are affordable. Our objective was to reduce the operational costs and to increase the efficiency and safety of clean-up operations," said Michael McDonald of Sandia's Intelligent Systems Dept. "VCE gives us the ability to do this work remotely with robots and to address all these issues. We can bring together all the nuclear, robotic, design and engineering experts, from wherever they are, and work interactively to develop ways to approach specific situations.

"Whether we need to remediate waste, develop new robot systems for manufacturing, or pre-view and simulate a new factory system, we can do it safely, efficiently and economically with VCE technology," McDonald added.

Sandia's Laboratory Directed Research & Development (LDRD) program, the Department of Energy's Robotics Technology Development Project (RTDP), and other internal Sandia programs such as TIE-In, which provides on-line access to Sandia technologies, collaborated on the development of VCE technology. RTDP is promoting VCE applications development, particularly in the area of Graphical Programming Technology, by teaming with university, industry and government sectors, and serving as a bridge to speed the implementation of VCE into practical engineering solutions.

Sandia is working with Deneb to commercialize VCE technologies, which when combined with Sandia-developed robotic controls technologies, will allow engineers, technicians, and operators to collaborate on projects.

VCE is a significant step beyond teleconferencing.

"Our implementation of VCE allows all of the engineers at disparate locations to communicate using the same dataset," said Jay P. Harrison, Deneb's senior vice president of research and technology. "VCE is truly interactive since it allows each participant to manipulate the full 3-D environment and actually run the simulation. Any collaborator can request the master token, stop the simulation and show the others an aspect of the design or manufacturing operation where a problem will occur. No other tool has ever offered that capability."

Working with Sandia, Deneb added VCE capability to its TELE-interactive Graphics Robot Instructional Program (TELEGRIP), a simulation-based control system for the development and im-plementation of robots with integrated sensors, graphic representation, real-time reasoning and elec-tromechanical systems. The program is designed for hazardous or complex environments in which specific conditions may be unknown or likely to change when executing robot operations.

Sandia and the National Institute of Standards and Technology (NIST) demonstrated VCE's initial capabilities last spring at the Third Annual National Manufacturing Technology Conference at NIST headquarters in Gaithersburg, Md. A geometric model of an experimental, high-precision machining tool was loaded onto workstations at Sandia and at NIST. Engineers at both sites ran control simulation programs interactively on the machining tool. Actions initiated by either engineer were transmitted immediately to both workstations, allowing them to cooperatively interact with the simu-lated machining tool, modify its motions and see results despite being 2000 miles apart.

"This demonstration is a good example of the value of industry and government teaming," McDonald said. "Together, Sandia and Deneb cost-effectively developed and deployed technologies that would be prohibitively expensive for any single organization to produce."

Deneb's President Robert Brown predicts the VCE technology will have a large impact on Department of Defense contractors, the aerospace and automotive industries, manufacturing and research institutions.

"In the aerospace industry, the prime contractor and many first-tier and second-tier subsuppliers need to coordinate product development, product design, manufacturing processes, design for assembly and design for manufacturability," Brown said.

Deneb Robotics, founded in 1985, is a world leader in 3-D graphics-based factory simulation, telerobotic, and virtual reality software. Deneb's simulation and telerobotic software is widely used in the aerospace, automotive, defense, environmental, medical, nuclear, and research communities.

Sandia National Laboratories is a multiprogram Department of Energy laboratory, operated by a subsidiary of Lockheed Martin Corp. With main facilities located in Albuquerque, N.M., and Liver-more, Calif., Sandia has broad-based research and development programs contributing to national de-fense, energy and environmental technologies, and economic competitiveness.

New York City Wireless Network Is Operational Citywide

In a historic milestone for municipal first responder communications, the New York City Department of Information Technology and Telecommunications (DoITT) and Northrop Grumman Corporation today announced that the New York City Wireless Network (NYCWiN) is operational citywide. NYCWiN is a high-speed, mobile data network representing the most aggressive commitment by any municipality in the United States to provide a next-generation public safety infrastructure. The network is now operational across New York City's more than 300 square miles and exceeds requirements for coverage and data throughput speed.

"With Northrop Grumman, we have worked to deploy a network and capabilities that will propel New York City into the 21st century," said DoITT Commissioner Paul J. Cosgrave. "NYCWiN will provide robust, reliable and resilient data communications, enhancing coordination and ensuring that critical information reaches our mobile workforce, to the benefit of all City agencies and the people we serve. We are pleased to have worked collaboratively on this significant and transformative initiative with Northrop Grumman, which has proven itself in the field of public safety communications."

NYCWiN provides first responders high-speed data access to support large file transfers, including fingerprints, mug shots, City maps, automatic vehicle location, and full-motion streaming video. A fully-interoperable, IP-based network, NYCWiN enhances coordination by linking first responder personnel, on-scene, wirelessly with incident managers at remote sites through real-time data and video feeds.

"The development of NYCWiN represents a major accomplishment and opportunity to transform the way New York City government operates, by improving the capabilities and efficiency of public safety and service agencies" said Tom Shelman, vice president and general manager of Northrop Grumman Information Systems' Civil Systems Division. "NYCWiN is a model for how states, cities, and counties can deploy and manage their own mission-critical communications infrastructure."

For example, DoITT and the New York City Police Department (NYPD) are now working toward the installation of wireless modems in 1,800 marked patrol fleet vehicles, which will enable officers in the field to access critical applications via NYCWiN previously available only from their desktops - mobile access to mug shots and moving traffic violations information being prime examples.

"The NYCWiN technology platform provides data transfer speeds 100 times that of our legacy networks and enables us to deploy a wealth of broadband applications - including streaming video to increase situational awareness among our first responders," said Steve Harte, DoITT's Associate Commissioner of Wireless Technologies. "Leveraging this capability, we have also created an interoperable video management system (IVS) that allows the New York City Mayor's Office, NYPD, Fire Department, Office of Emergency Management, and a variety of other agencies to access shared, incident-based video feeds as needed."

Recent examples of IVS deployment include Operation Safe PATH 2009 - a full-scale, multi-agency exercise to test the City's and the Port Authority's response to an Improvised Explosive Device (IED) detonation on a New Jersey-bound Port Authority Trans-Hudson (PATH) train - and US Airways Flight 1549, which ditched into the Hudson River last January. In each case the IVS was mobilized at the incident scene, enabling first responder command units to stream video back to the City's Emergency Operations Centers.

NYCWiN can also be leveraged by City agencies to improve service delivery to New Yorkers. Automated water meter reading, traffic signal control and myriad handheld inspectional programs are now planned or underway, allowing New York City's mobile workforce to not only to function more efficiently, but also to realize substantial cost savings across participating agencies.

Working with partner Grey Island, Northrop Grumman is also helping the City deploy an automated vehicle location system in nearly 400 vehicles across more than a dozen City agencies. This effort will help meet Mayor Bloomberg's PlaNYC goals for improved sustainability by decreasing vehicle usage, improving gas consumption, and providing real-time management of the City's vehicle fleet.

To enable these and other high-speed mobile applications, DoITT, Northrop Grumman and IPWireless deployed NYCWiN's extensive communications infrastructure across the City's more than 300 square miles, covering all five boroughs of New York City. In addition to building the system, Northrop Grumman manages day-to-day network operations, including management of 24-hour network operations centers.

Commissioner Cosgrave continued: "While implementation of NYCWiN represents a substantial public safety and infrastructure achievement, it also illustrates how New York City is transforming itself into a mobile virtual organization. By deploying new wireless applications, we will enhance service delivery to New Yorkers, improve the efficiency of City operations, and raise the bar for the administration of municipal government."

DoITT transforms the way New York City interacts with its residents, businesses, visitors and employees by leveraging technology to improve services and increase transparency, accountability and accessibility across all agencies. In 2006, DoITT awarded Northrop Grumman a five-year contract to implement the New York City Wireless Network, the nation's most comprehensive, high-performance mobile broadband infrastructure.

Northrop Grumman Corporation (NYSE: NOC) is a leading global security company whose 120,000 employees provide innovative systems, products, and solutions in aerospace, electronics, information systems, shipbuilding and technical services to government and commercial customers worldwide.

How War Will Be Fought in the 21st Century

Nicholas Negroponte, head of MIT’s Media Lab, observed that the information age is fast replacing atoms with bits; movies on film with packets on the Internet; print media with digital media; and wires with digital radio waves.

Negroponte does not apply the bits-for-atoms principle to warfare, but Bruce Berkowitz, in The New Face of War, does. According to Berkowitz, a senior analyst at RAND and a former intelligence officer, future wars will not be won by having more atoms (troops, weapons, territory) than an opponent, but by having more bits . . . of information.

Berkowitz argues that atoms that used to be big winners will become big losers to information technology. Reconnaissance sensors will quickly find massed troops, enabling adversaries to zap those troops with precision-guided weapons. Fortifications will tie armies down to fixed locations, making them sitting ducks for smart bombs. Cheap cyber weapons (e.g., computer viruses) will neutralize expensive kinetic weapons (e.g., missile defenses).

Berkowitz sums up the growing dominance of bits over atoms: “The ability to collect, communicate, process, and protect information is the most important factor defining military power.” The key word here is: “the most important factor.” The New Face of War gives many historical examples of information superiority proving to be an important factor in defining military power, such as the allies breaking German and Japanese codes during World War II and Union forces employing disinformation to mislead Confederates in the Civil War. But the digital revolution has transformed information from supporting actor to leading lady.

Evidence that this revolution has already occurred abounds. In the 1990 Gulf War, smart weapons turned Saddam’s strength (concentrated troops and tanks) into liabilities. More recently, al-Qa’ida used the global telecommunications net to coordinate successful attacks by small, stealthy groups who triumphed through information superiority (knowing more about their targets than their targets knew about them).

Perhaps the biggest effect of information technology on warfare will be the elimination of the concept of a front, according to Berkowitz. If fronts persist at all, they will live in cyberspace where info-warriors battle not over turf, but over control of routers, operating systems, and firewalls. Even so, The New Face of War argues that there will be no electronic “Pearl Harbors” on the emerging battlefield of bits because disabling a nation’s information technology (IT) infrastructure will be too hard even for the most sophisticated cyber-warriors. Well-timed, pinpoint computer network attacks will be much more likely.

Dr. Berkowitz’s vision of the future is probably right in many respects and off target in a few others. But, regardless of its accuracy, his book surfaces critical questions for the Intelligence Community.

First, the things he gets right and what these mean for intelligence: Information technology has changed warfare not by degree, but in kind, so that victory will increasingly go to combatants who maneuver bits faster than their adversaries. Thus, intelligence services will need an increasing proportion of tech-savvy talent to track, target, and defend against adversaries’ IT capabilities. As countries like China, India, Pakistan, and Russia grow their IT talent base—and IT market share—faster than the United States, the strengths of their intelligence services will likely increase relative to those of US intelligence.

Because cyber-wars will be played out on landscapes of commercial IT, intelligence agencies will need new alliances with the private sector, akin to existing relationships between nation states. And the Intelligence Community will have to confront knotty problems such as: performing intelligence preparation of cyber battlefields; assessing capabilities and intentions of adversaries whose info-weapons and defenses are invisible; deciding whether there is any distinction between cyber defense and cyber intelligence; and determining who in the national security establishment should perform functions that straddle the offensive, defensive, and intelligence missions of the uniformed services and intelligence agencies.

The growing importance of IT in warfare will also change the way intelligence agencies support atom-based conflicts. New technology will collect real-time intelligence for fast-changing tactical engagements, but the mainstay product of the Intelligence Community, serialized reports, is far too slow for disseminating these high-tech indications and warnings. Faster means of delivering—and protecting—raw collection must be devised, so that real-time intelligence can be sent directly to shooters without detouring through multiple echelons of military intelligence analysts. Also, remote sensors designed to report on the capabilities, intentions, and activities of armed forces, will not find lone terrorists. Radically new sensing networks that blanket the globe will be needed to collect pinpoint intelligence on individual targets.

The distinction between intelligence and tactical operations data (such as contact reports and significant activity reports) will blur as national intelligence means are focused on real-time tactical missions. All-source analysts will need to add tactical operations reporting to their diet of HUMINT, SIGINT, IMINT, OSINT and MASINT.

Now, the areas in which The New Face of War misses the mark: First, military power in the future will not flow solely from precision zapping and deployment of small, networked forces. Some missions, such as peacekeeping, will always demand the highly visible presence of large forces. And if numbers do not matter anymore, as Berkowitz suggests, why worry about North Korea’s million-plus army? The bottom line is that as intelligence agencies get better at tracking and collecting on individuals terrorists, they will still need robust targeting and force protection capabilities against large conventional forces.

The evolution of media, with which we began this discussion, teaches powerful lessons about the folly of too quickly abandoning the old for the new. The printing press did not abolish handwriting; motion pictures did not kill live theater; television did not doom radio; and the Internet did not extinguish magazines. For each of these transitions from old to new, there were plenty of pundits who prophesized the demise of legacy forms of communication at the hands of new information technology.

Berkowitz is in good company, though. The US Air Force was so sure that close air combat was obsolete, that the first F-4 fighters did not have cannons. They relied instead on high-tech air-to-air missiles—until the F-4s fell victim to the cannons of North Vietnamese MIGs in “obsolete” air combat. Low-tech weapons on the F-4 ultimately did not yield to high-tech missiles; they simply moved over and made room for them. And today’s newest generation of fighters still retain cannons.

There is an important lesson here for intelligence agencies: As novel collection, analytic, and dissemination technologies are acquired, traditional tradecraft should be retained to cope with traditional adversaries and tactical situations. Just as missiles did not replace cannons, legacy tradecraft will need to be preserved but continuously improved to track changes in conventional warfare. For example, imaging satellites will always be essential, but they will have to steadily increase resolution and dwell time. Ditto for traditional SIGINT and MASINT collection systems.

I also disagree with Berkowitz’s contention that there can be no electronic Pearl Harbors. The inexorable migration to the Internet of such diverse functions as telephony, power plant control, commercial data networks, and defense communications has already created a “one-stop-shop” target for info-warriors. In essence, industrialized nations have done in cyberspace what Berkowitz says is so perilous in physical space: namely, concentrated all their eggs in one basket. Intelligence agencies should not, therefore, abandon the hope of severely crippling a cyber enemy, nor should they assume a cyber enemy could not return the favor.

Despite these shortcomings, The New Face of War is an eminently enjoyable read, jam-packed with fascinating historical examples of information technology at war. Dr. Berkowitz’s experience as an intelligence officer comes through clearly in his book, providing important context and relevance for intelligence collectors, analysts, and disseminators.

Five Steps To Better Online Privacy

5 steps to better online privacy

1. Only conduct business, visit sites or become involved with web sites that have adequate privacy policies that cover at least:

• To whom your information will be passed onto
• Why the information is being collected
• How the information will be used
• How you can access information the organisation holds about you

2. Install and use privacy enhancing software including:

• Firewall
• Cookie Remover
• Web Bug Remover
• Anonymous Web Browsing
• Encrypted Email
• Advertising Filters
• Anti-Spam Tools
• Anti-Spyware Tools
• Further Information

3. Opt out of all further contact with the organisation when filling in forms unless you know you want to be in further contact with it

4. Only give as much personal information as you are comfortable with

5. Use an online identity and free email service to protect against giving out your details to spammers

Microsoft Unleashes Natal Project (2009)

New General Permits For Storm Water Construction, Coal Mining Wastewater Discharges

The Kentucky Department for Environmental Protection (DEP) has issued new general permits for storm water discharges associated with construction activity and for wastewater discharges associated with coal mining activities within the Commonwealth of Kentucky. The permits go into effect Aug. 1, 2009.

The storm water general permit requires all construction site operators engaged in clearing, grading and excavating activities that disturb one acre or more of land to obtain permit coverage under the National Pollutant Discharge Elimination System (NPDES) for their construction storm water discharges. Conditions of the permit include compliance with approved erosion/sediment control and storm water management plans, self-monitoring and record keeping.

The storm water permits are implemented based on best management practices (BMPs) such as diversion, detention, erosion control, sediment traps, gravel construction entrances, covered storage, spill response, stream buffer zones and good housekeeping. Permittees are required to conduct inspections weekly and the day after any rainfall event resulting in runoff. They must also maintain on-site copies of written inspection reports and any associated enforcement actions.

Persons seeking storm water general permit coverage must file a Notice of Intent (NOI) to discharge either electronically or on paper. NOIs submitted electronically will be processed within seven days of receipt and paper NOIs within 30 days.

The Division of Compliance Assistance and DOW will offer four half-day training sessions in August to provide an overview of the new permit requirements. Visit http://www.dca.ky.gov/Training-Events/ for the dates and locations and to register.

The coal general permit authorizes discharges from coal-mining activities. The permit protects waters of the Commonwealth by requiring technology and water-quality-based effluent limitations and other protective practices, such as the implementation of a BMP plan. The division coordinated with the U.S. Environmental Protection Agency in the development of this permit to address recent actions related to coal mining taken at the federal level.

The coal general permit is not available to those intending to discharge to waters that are impaired by contaminants related to coal mining, for mines discharging within five miles upstream of a public water supply, or for discharges to publicly owned lakes, outstanding state resource waters, outstanding national resource waters or waters classified as cold-water aquatic habitats. An individual Kentucky Pollutant Discharge Elimination System permit must be applied for in those situations.